Labshake search
Citations for Lonza :
501 - 550 of 743 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Biochemistry 2024Quote: Human HeLa cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza, USA) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2023Quote: ... RNP were formed by mixing 5 to 9 μgr base editor protein with 1.5 μgr of sgRNA in 20 μL of P3 buffer (Lonza, Amaxa P3 Primary Cell 4D-Nucleofector Kit ...
-
bioRxiv - Developmental Biology 2023Quote: ... were cultured at 37°C and 5% CO2 in EGMTM Endothelial Cell Growth Medium with BulletKitTM (Lonza CC-3124) and 1x antibiotic-antimycotic (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... Cas9-gRNA ribonucleoproteins were assembled as described previously53 and nucleofected into 5×106 monocytes in 100μL nucleofection buffer (Human Monocyte Nucleofection Kit, Lonza) using a Nucleofector 2b (Lonza ...
-
bioRxiv - Genomics 2023Quote: ... Cells were grown at 37°C and 5% CO2 and passed with Hepes buffered saline solution (Lonza, CC-5024) and 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: Primary human alveolar epithelial cells (HPAECs, CellBiologics) were cultured at 37°C and 5% CO2 with SABM medium (Lonza), SAGM supplements (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 300μM single stranded oligodeoxynucleotides (ssODN: 5’gggtccagggtggctgtcactcat ccttttttctggctaccaaaggtgcagataattaaGaagaagctggatcttagcaacgtccagccaagtgtggctcaaaggataatatc aaacacgtcc 3’) and the P3 Primary Cell 4D reaction mix (Lonza). We screened a minimum of 96 clones for genetic editing ...
-
bioRxiv - Biochemistry 2024Quote: Human lung carcinoma A549 cells (ATCC) were grown at 37°C in 5% CO2 using Dulbecco’s Modified Eagle Medium (Lonza) supplemented with 10% FBS superior (Biochrom ...
-
bioRxiv - Cell Biology 2024Quote: Primary human mammary epithelial cells (HMECs) were cultured at 37°C with 5% CO2 in MEBM basal medium (Lonza) supplemented with MEGM SingleQuots (Lonza ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The product was purified and 2 µg were added to the RNP and diluted in 100 µL P3 nucleofection buffer (Lonza). This mixture was nucleofected with 2×106 stimulated human primary T cells using the 4D-Nucleofector (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... 1.0×106 clonal Kp03 landing pad cells were electroporated in 100 μL Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 μg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The supernatant was removed and the cells were resuspended in 100 µL of nucleofector solution from P3 Primary Cell 4D-Nucleofector Kit (Lonza) per transfection ...
-
bioRxiv - Genetics 2020Quote: ... All nucleofections were performed using 106 freshly-purified CD4 T cells in 100 μl nucleofection buffer using a Nucleofector 2b device (Lonza), based on previous optimisation studies (data not shown) ...
-
bioRxiv - Microbiology 2020Quote: ... transferred to a 100 μl nucleocuvette and pulsed using the program FF-137 on an Amaxa 4D-Nucleofector X Unit (Lonza). Cells were then resuspended in equilibrated ...
-
bioRxiv - Microbiology 2021Quote: ... Both resuspensions were mixed in a 100 μl cuvette (P3 Primary cells 4D-Nucleofector X kit L, V4XP-3024, Lonza). The programme FI-158 was used for electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... The same number of cells (2 x 106 cells) were lysed in 100 µl of 1% CHAPS/PBS and analyzed on 4-20% SDS-PAGE gel (Lonza). The envelope proteins were detected by 2F5 (specific for gp41 ...
-
bioRxiv - Neuroscience 2022Quote: ... the samples were rapidly transferred to glass Dounce homogenizers and homogenized in 750µL of endotoxin free water (Lonza W50-100). Homogenized samples were then diluted 1:5 in endotoxin free water in pyrogen-free glass tubes (Lonza N207 ...
-
bioRxiv - Neuroscience 2022Quote: ... and ssODN (1 μl,stock 100 μM) in 20 μl of nucleofection buffer P3 were nucleofected (program CA137, 4D-Nucleofector Device, Lonza) into 500,000 detached iPSCs (Deneault et al. ...
-
bioRxiv - Immunology 2022Quote: ... T cells were then electroporated with ribonucleoprotein (RNP) complexes of sgRNA and SpCas9 in 100 μL cuvettes using pulse code EH111 of the 4D nucleofector (Lonza). RNP complexes were generated by incubating 5 ug of chemically modified sgRNA with 10 ug HiFi SpCas9 for 15 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... 5 µg of NOSIP shRNA plasmids or control TRC2 plasmid was mixed with 100 µl Cell Line Nuceleofector Solution V (Lonza) and added to one million cells ...
-
bioRxiv - Genetics 2020Quote: ... hESCs were nucleofected with 2 μg of CRISPR and 3 μl ssODN (100 μm) using the P3 Primary Cell Kit L (Lonza). hESCs were then plated onto puromycin-resistant (DR4 ...
-
bioRxiv - Neuroscience 2020Quote: ... Effects of PI3K inhibition on Syk phosphorylation in mouse WT primary microglia was studied by plating 100 000 cells in 96-well plate in Dulbecco’s modified Eagle’s medium (DMEM, Lonza, Verviers, Belgium) supplemented with 2mM L-glutamine (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... 5,000 cells were plated in low-attachment 96-well plates containing 100 µL MEGM media (without BPE) (Lonza, CC-3150), 20 ng/mL FGF (Sigma Aldrich) ...
-
bioRxiv - Biophysics 2020Quote: ... The cell pellet was suspended in 100 μL electroporation medium and electroporated for either GFP-Nrx1β or NLG1-mCherry plasmids with the Amaxa Nucleofector system (Lonza), using 500,000 cells per cuvette and 3 μg DNA ...
-
bioRxiv - Immunology 2020Quote: ... and 5×106 cells seeded in 100-cm2 cell culture dishes in 12 mL RPMI supplemented with 10% fetal calf serum (Lonza), 1X non-essential amino acids (NEEA ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmid DNA composed of a 1:1 mixture of the targeting and the donor vectors was resuspended in 100 μL of P3 buffer (Lonza), containing 3 μL ATP (625 mM) ...
-
bioRxiv - Microbiology 2022Quote: ... 3 to 4×107 cells were transfected with 3 to 8 μg of DNA in 100 μl bloodstream form transfection buffer (Schumann Burkard, 2011) using program Z-001 on the Amaxa Nucleofector (Lonza). Limiting dilutions of the parasites were prepared in 48-well plates ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 pmol of the dsODN was mixed together with 100 µl homemade nucleofection solution to the RNP complex and electroporated using Nucleofector 2b (Lonza) with A23 program and 2 mm electroporation cuvettes.
-
bioRxiv - Molecular Biology 2022Quote: ... HEK293 cells were washed twice with PBS and 2 × 106 cells were resuspended in 100 μl of Solution V (Lonza) and then mixed with 5 μg purified sgRNA expression vector or the empty vector as a negative control before nucleofection using program Q-001 of a Nucleofector™ 2b (Lonza) ...
-
bioRxiv - Cell Biology 2022Quote: ... EBs were seeded at 100–150 EBs per T175 or 250–300 per T225 flask in factory medium consisting of X-Vivo 15 (Lonza) supplemented with Glutamax (Gibco) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Immunology 2024Quote: ... The reaction contained 400 pmol of Cas9 protein and 1 × 107 of the transduced NK cells in 100 µL of P3 solution (Lonza). Immediately after electroporation ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell and siRNA mixture resuspended in 100 µl of Nucleofector Solution for Human Keratinocytes provided with Human Keratinocyte Nucleofector kit (VPD-1002, Lonza). Nucleofection performed on program X-001 of Amaxa Biosystems Nucleofector II electroporator transfection unit ...
-
bioRxiv - Bioengineering 2023Quote: ... RNPs were further complexed with Alt-R Cas9 electroporation enhancer (IDT, 100-nt ssDNA) with a 1:1 mole ratio of enhancer to RNP in supplier-recommended buffers (Lonza). For LNP delivery ...
-
bioRxiv - Cell Biology 2023Quote: ... and 2000 p mol of a degron-tagged control protein (mTagBFP2-RxxG) in a 100 µl nucleofection reaction (4D nucleofector kit SE plus supplement SF1, Lonza) 14 hours following nucleofection ...
-
bioRxiv - Cancer Biology 2023Quote: ... The dissociated GSCs (1 × 106 cells) were resuspended in 100 μl of supplemented solution of the Human Stem Cell Nucleofector Kit 1 (Lonza) containing a combination of the px458 plasmid targeting each gene and the ssODN and then electroporated using B-016 program of Nucleofector 2b (Lonza) ...
-
bioRxiv - Immunology 2023Quote: ... Transfections were performed with an Amaxa Nucleofector device: 2×106 cells were resuspended in 100 μL Nucleofector solution T (Lonza) and added to 2 µg of pcDNA3.1 expression vector encoding full-length IL-2Rβ ...
-
bioRxiv - Microbiology 2023Quote: Primary monocytes (3 × 106 cells/transfection) were washed with 1X PBS and resuspended in 100 μl of P3 Primary Cell Nucleofector solution (Lonza) containing either 1000 ng empty vector (EV ...
-
bioRxiv - Immunology 2023Quote: ... cells were also mixed with 1.4- 2 µg of plasmid homology donors or 100 pmol phosphorothioate-modified ssODNs as previously described.59 Electroporations were performed with the 4D-X Nucleofector (Lonza). K562 cells used pulse code FF-120 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 100 μL of YEA medium containing 1% (w/v) microwave-heated low-melting point agarose (SeaPlaque agarose, 50101; Lonza) was gently added to the central area ...
-
bioRxiv - Genomics 2023Quote: ... purified Percoll-enriched mature schizonts (∼20 μl packed volume) were suspended in 100 μl of P3 primary cell solution (Lonza) containing 60 μg of linearized repair plasmid DNA (repair plasmid 1 and 2 separately in two separate transfection experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... and the ssODN (1 μl; stock 100 μM, IDT) in 20 μl of nucleofection buffer P3 (P3 Primary Cell NucleofectorTM Solution, Lonza) were nucleofected (program CA137 ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were pelleted and resuspended in 100 μl of P3 transfection solution (82 μl Amaxa Buffer and 18 μl P3 supplement; Lonza) and 10 μl of DNA mix ...
-
bioRxiv - Cell Biology 2023Quote: ... JAWS transfection was achieved using 20 μg DNA and 2 x 106 million cells per 100 μl nucleofection solution from the Amaxa Nucleofector Mouse Dendritic Cell kit (Lonza), and the Y-001 program ...
-
bioRxiv - Cell Biology 2023Quote: ... and performed nucleofection where 1 × 106 of the selected clone were resuspended in 100 μl of P3 buffer (V4XP-3024, Lonza) containing 20 μg Alt-R® S.p ...
-
bioRxiv - Neuroscience 2024Quote: The dissociated neurons from lumbar DRGs were suspended in 100 μL of Amaxa electroporation buffer (Lonza Cologne GmbH, Cologne, Germany) with siRNAs (0.2 nmol per transfection) ...
-
bioRxiv - Molecular Biology 2024Quote: ... was mixed with 10 μg of pX458-tetherin in total volume of 100 μL and nucleofection was performed with the AMAXA nucleofector (Lonza) using the A-27 program ...
-
bioRxiv - Immunology 2024Quote: ... They were then transfected by nucleofection with 3 μg of plasmid DNA in 100 μl of Cell Line Nucleofector Solution V (Lonza) using the V-001 program (Amaxa Biosystems) ...