Labshake search
Citations for Lonza :
1 - 50 of 9615 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using the Amaxa Nucleofector kit V program B-023 (Lonza) or Xcell PBS protocol ...
-
bioRxiv - Immunology 2024Quote: ... cultured in X-VIVO 15 medium (Lonza, Basel, Switzerland) supplemented with 4 % human AB plasma (Innovative Research ...
-
bioRxiv - Immunology 2024Quote: ... 5×104 APC were seeded together with 1×105 CD4+ T cells in the presence of relevant peptides at 2.5 ng/ul diluted in X-VIVO 15 medium (Lonza, Basel, Switzerland) supplemented with 4 % human AB plasma (Innovative Research ...
-
bioRxiv - Microbiology 2024Quote: ... Cell pellets were carefully enrobed in an equal volume of molten 5% low-melting temperature agarose (Lonza, Rockland, ME) and allowed to cool ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cell lysis was performed for 5 min at room temperature in ACK lysing buffer (Lonza, #10-548E). For flow cytometry ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were tested to verify mycoplasma negativity using the MycoAlert Mycoplasma Detection Kit (Lonza, Visp, Switzerland).
-
bioRxiv - Cancer Biology 2024Quote: Transient knockdown was performed using the Amaxa 4D Nucleofector system (Lonza, CH). SiRNAs were designed with the Sfold 36 software and the tool provided by Dharmacon ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protocols according to the SG Cell Line 4D-Nucleofector X Kit L (Lonza) were followed ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were regularly authenticated by STR profiling (LabCorp, Burlington, NC) and tested for mycoplasma (MycoAlert, Lonza #LT07-218). To create a chronic CuHiexposure model ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were mycoplasma negative based on routine testing using MycoAlert Mycoplasma Detection Kit (Lonza). Cell line authentication was routinely performed by the Australian Genome Research Facility (AGRF).
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were regularly tested for mycoplasma with MycoAlert per manufacturer’s protocol (LT07-318, Lonza, Basel, Switzerland).
-
bioRxiv - Cancer Biology 2024Quote: ... with final concentrations as indicated : X-VIVO 10 (Lonza, BE04-380Q) supplemented with 20% BIT 9500 Serum Substitute (StemCell technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 50 U/mL penicillin/streptomycin (Lonza). HEK293TT cells were kindly provided by Prof Greg Towers (University College London (UCL) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were tested negative for Mycoplasma using the Mycoalert Plus Mycoplasma detection kit (Lonza) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: ... Cells were cultured in Lonza RtEGM medium (Lonza) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2024Quote: ... were cultured on fibronectin-coated plates in EBM-2 Basal Medium with EGM-2 MV supplements (Lonza) and 10 ug/mL VEGF-C (RnD Systems) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a control siRNA (D-001810-01-20 ON-TARGET plus Nontargeting siRNA #1) were prepared for electroporation using the Lonza SF Cell Line 4D-Nucleofector™ X Kit (V4XC-2012; Lonza) according to the manufacturer’s instruction with minor alterations ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lines were authenticated by STR testing upon receipt and were routinely tested and verified as mycoplasma negative using the MycoAlert kit (Lonza, Cambridge, MA). Human recombinant TNF was purchased from BioLegend Inc (San Diego ...
-
bioRxiv - Molecular Biology 2024Quote: ... The culture medium or the DNA harvested from the cultures were tested for mycoplasma contamination using a MycoAlert Mycoplasma Detection Kit (Lonza, LT07-418) or e-Myco PLUS PCR Detection Kit (BOCA scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were seeded at a density of 7500 cells in 6-cm3 tissue culture dish in duplicate in 0.8% SeaPlaque GTG agarose (Lonza 50111) mixed with Iscove’s Modified Dulbecco’s medium (Gibco 12200-036 ...
-
bioRxiv - Cell Biology 2024Quote: ... and Program CA-137 on the 4D Nucleofector device (Lonza). Two days post-transfection ...
-
bioRxiv - Cell Biology 2024Quote: ... This was accomplished using the P3 Primary Cell 4D-Nucleofector X Kit S (Lonza) and Program CA-137 on the 4D Nucleofector device (Lonza) ...
-
bioRxiv - Cell Biology 2024Quote: ... Differentiation medium consisted of 50 % DMEM with pyruvate and 50 % BEBM supplemented with BEGM singlequots (except amphotericin B, triiodothyronine, and retinoic acid) (Lonza). Medium was supplemented with 100 nM all-trans retinoic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... Erythrocyte cultures were established in 6 well plates using HL-1 medium (Lonza, Basel, Switzerland) supplemented with 20% human serum type A+ (Interstate Blood Bank) ...
-
bioRxiv - Cell Biology 2024Quote: hDPSCs (PT-5025; Lonza, Basel, Switzerland) derived from human dental pulp tissues were purchased from Lonza for use in this study ...
-
bioRxiv - Cell Biology 2024Quote: ... derived from human dental pulp tissues were purchased from Lonza for use in this study ...
-
bioRxiv - Molecular Biology 2024Quote: ... using the MycoAlert Mycoplasma Detection Kit (Lonza LT07-318).
-
bioRxiv - Molecular Biology 2024Quote: ... 1 × 106 wild-type K562 cells were electroporated in 100 μl of Amaxa solution (Lonza Nucleofector 2b, program T-016) with 1 µg of PiggyBac expression vector (PB200A-1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were electroporated with Lonza 4D-Nucleofector™ in 16-well Nucleocuvette Strips (Lonza, V4XP-3032). Cas9 at 6µg (Integrated DNA Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: HUVECs (Lonza) and RFP-HUVECs (Angioproteomie ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were screened for mycoplasma with MycoAlert detection kit (Lonza) at receipt or thaw ...
-
bioRxiv - Cancer Biology 2024Quote: ... Red blood cells were lysed with ACK buffer (Lonza, #10-548E), and cells were cultured for 2 days in IMDM (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell Line NucleofectorTM Kit V (Catalog #: VCA-1003) (Lonza) was used for transfection procedure according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... were incubated at 37°C in a 5% CO2 humidified atmosphere and propagated in Dulbecco’s modified Eagle’s medium (DMEM; Lonza) supplemented with 10% fetal bovine serum ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested with trypsin, pelleted (500 g, 5 min, 4°C) and resuspended in PBS (pH 7.4) containing EDTA (Lonza) and 10% fetal bovine serum ...
-
bioRxiv - Microbiology 2024Quote: ... Program FP158 of the Amaxa 4D Nucleofector X (Lonza) was used for electroporation ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293T cells (1.7 × 105 cells/well in 12-well plates) were grown for 24 h in supplemented DMEM (Lonza), before to be incubated with 20 µg/mL 55Fe-transferrin for 24 h and transiently transfected with wild-type or mutated FPN1-V5 plasmid constructs ...
-
bioRxiv - Cancer Biology 2024Quote: ... All cell lines were tested and found negative for mycoplasma (MycoAlert Mycoplasma Detection Kit; Lonza). The authors did not authenticate these cell lines ...
-
bioRxiv - Cancer Biology 2024Quote: ... and cultured in AGM™ Astrocytes Growth Medium BulletKit™ (Lonza). NHA were passaged using Trypsin 0.25% (Quality Biological ...
-
bioRxiv - Cancer Biology 2024Quote: ... and MycoZAP Plus-PR (Lonza). GSCs were passaged using TrypLE Express (Gibco) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Normal human astrocytes (NHA) were purchased from Lonza, and cultured in AGM™ Astrocytes Growth Medium BulletKit™ (Lonza) ...
-
bioRxiv - Neuroscience 2024Quote: ... Individual larvae were embedded in a droplet of 1.5% low melting point agarose (50100, Lonza) centered in a 60 mm x 15 mm Petri dish ...
-
bioRxiv - Physiology 2024Quote: ... Primary human skeletal muscle cells were obtained from Lonza (SkMC, #CC-2561) and the Hospices Civils de Lyon and were cultured in growth medium consisting of DMEM/F12 (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Two million E14 ESCs were nucleofected with paired Kdm3b targeting and donor plasmids (5 µg each) using the Amaxa 4D-Nucleofector protocol (Lonza) and selected with blasticidin S hydrochloride (Research Products International ...
-
bioRxiv - Physiology 2024Quote: ... Cells were nucleofected using the Amaxa 4D nucleofector (Lonza) with pre-annealed ribonucleoprotein complexes of sgRNAs and recombinant Cas9 protein (IDT ...
-
bioRxiv - Cell Biology 2024Quote: ... containing the appropriate guide RNA (gRNA) sequences (CGCTCAACTCGGCCATGCGC; GCAACAGATGGAAGGCCTCC) using the AmaxaTM nucleofectorTM kit V (Lonza #VCA-1003). Monoclonal lines were screened for puromycin sensitivity ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were then passaged as previously described and 8×105 cells were resuspended in 100 µl of nucleofector solution (Lonza, VPH-5012). Depending on the experiment ...
-
bioRxiv - Cancer Biology 2024Quote: Mycoplasma was monitored with MycoAlert® PLUS Mycoplasma Detection Kit (Lonza, Cat# LT07-705) in April 2022 and the cell line was used in February 2023 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were confirmed to be mycoplasma-free based on a luminescence-based enzymatic assay (MycoAlert®, Lonza, Cat# LT07-118) conducted within 1 week of the commencement and completion of the experiments ...
-
bioRxiv - Cell Biology 2024Quote: HUVEC and HAEC were cultured according to the manufacturer’s recommendations in EBM2 (Lonza#CC-3162) with growth factors (Lonza#CC-3162 ...