Labshake search
Citations for Active Motif :
1451 - 1500 of 1680 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... using magnetic beads (Active Motif) diluted in commercial ChIP-buffer (Active Motif ...
-
bioRxiv - Molecular Biology 2019Quote: ... a commercial hypotonic solution (Active Motif) was used to lyse cellular membranes but retain intact nuclear membranes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 25 µg of sample chromatin was mixed with 50 ng spike- in Drosophila chromatin (53083; Active Motif). Mixture of experimental chromatin and spike- in chromatin was then incubated with a mix containing 4 µg of H3K4me3 antibody (CS200580 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2 µg of spike-in antibody (104597; Active Motif) at 4°C overnight ...
-
bioRxiv - Molecular Biology 2019Quote: ... diluted in commercial ChIP-buffer (Active Motif) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and RNA digestion solutions (Active Motif). The resulting samples of DNA were further purified using phenol:chloroform extraction procedures ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies were used at the following dilutions: anti-HIRA mouse monoclonal (WC119, Active Motif) IF 1:200 and Western Blot (WB ...
-
bioRxiv - Cell Biology 2019Quote: ... anti-RNAPIIS7ph (61087, Active Motif) IF 1:300 ...
-
bioRxiv - Genetics 2019Quote: ... H3K27Ac (Active Motif #39134), H3K4Me2 (Millipore #07-030) ...
-
bioRxiv - Genetics 2019Quote: ... H3K4Me3 (Active Motif #39916), H3K27Ac (Active Motif #39134) ...
-
bioRxiv - Genetics 2019Quote: ... Samples were diluted and immunoprecipitated with antibodies specific for H3K27Ac (Active Motif # 39134), H3K4Me2 (Millipore # 07-030) ...
-
bioRxiv - Genomics 2019Quote: ... Chromatin immunoprecipitation and library preparation and sequencing were performed by Active Motif (catalog number 25006 and 25046 ...
-
bioRxiv - Genomics 2019Quote: ... The libraries were generated with the Illumina Nextera DNA Library Prep kit and were sequenced by Active Motif and NIEHS Sequencing core by Illumina HiSeq 2000 and NextSeq 500 systems with 42bp paired-end reads on each sample ...
-
bioRxiv - Genomics 2019Quote: ... ChIP-qPCR was performed by Active Motif (Carlsbad, CA) using an anti-PGR antibody (sc-7208 ...
-
bioRxiv - Genomics 2019Quote: ... PLCL1_cR: CAGGAAACAAGCAGGAGTAGG and Untr12 (Catalog #71001, Active Motif, Carlsbad, CA). PGR binding events were calculated according to an equation published in the user’s manual of Active Motif catalog number 12970399.
-
bioRxiv - Molecular Biology 2019Quote: ... together with 4μg spike-in antibody (anti-H2Av, Active motif) together with 4μg spike-in antibody (Active motif ...
-
bioRxiv - Molecular Biology 2019Quote: ... together with 4μg spike-in antibody (Active motif) was added alongside with 40μL prewashed protein G Dynabeads (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... using 10mg of antibody abcam ab992 together with 40ng of Drosophila melanogaster spike-in chromatin (Active motif 53083) and spike-in antibody (Active motif 61686) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Anti-H3K4me3 antibody (Cat#39159; RRID: AB_2615077) was purchased from Active Motif (Carlsbad, CA). Anti-H3K27ac (Cat#ab4729 ...
-
bioRxiv - Genomics 2019Quote: Extraction of nuclear proteins and coimmunopreciptation were performed using the Universal Magnetic Co-IP Kit (Active Motif). Briefly ...
-
bioRxiv - Genomics 2019Quote: ... ChIP-seq assays were conducted with antibodies against H2A.Z (39647, Active Motif) and MYC-tag Mouse (2276 ...
-
bioRxiv - Genomics 2019Quote: ... 5 million cells per replicate were incubated with 5 ug (Histone) or 7.5 ug (Oct4) antibody overnight at 4’C (antibodies: H3K9me3: abcam AB8898; H3K27Ac: Active Motif 39133; H3K4me3: Active Motif 39159; Oct4: Santa Cruz sc-8629). Antibody-bound chromatin was incubated with Protein G Dynabeads (Invitrogen ...
-
bioRxiv - Genomics 2019Quote: ... SUZ12 (Active Motif 39357), total histone H3 (Cell Signaling Technology 3638) ...
-
bioRxiv - Genomics 2019Quote: ... 5 million cells per replicate were incubated with 5 ug (Histone) or 7.5 ug (Oct4) antibody overnight at 4’C (antibodies: H3K9me3: abcam AB8898; H3K27Ac: Active Motif 39133 ...
-
bioRxiv - Genomics 2019Quote: ... Drosophila chromatin and Drosophila H2AV antibody (Active Motif 39715) were added to regular ChIP assays as described previously (Egan et al. ...
-
bioRxiv - Genomics 2019Quote: ... Spike-In chromatin (Active Motif, 53083) and Spike-in antibody (Active Motif ...
-
bioRxiv - Genomics 2019Quote: ... and Spike-in antibody (Active Motif, 61686) were used according to manufacturer instructions.
-
bioRxiv - Genomics 2019Quote: ... Spike-In antibody (61686, Active Motif, Lot# 00419007), p300 (sc-584 ...
-
bioRxiv - Genomics 2019Quote: H3K27ac (39133, Active Motif. Lot # 31814008), Spike-In antibody (61686 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Primary antibodies included total H3 1:10,000 (Active motif 39763), H3K4me3 1 ...
-
bioRxiv - Biochemistry 2019Quote: ... DNMT1 (Active Motif cat. # 39905 Lot# 12914002), LAMP1 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2019Quote: Cytoplasmic extracts were generated by disrupting cells using hypotonic buffer (Active Motif, Carlsbad, CA) and pelleting the cell debris by centrifugation at 14000 × g for 10 min at 4 °C ...
-
bioRxiv - Genetics 2019Quote: ... Antibodies for H3K9me3 (Active Motif, 39161) and C(3)G (Anderson et al ...
-
bioRxiv - Molecular Biology 2019Quote: ... IP was performed using ChIP-IT high sensitivity kit (53040, Active Motif) with some modifications ...
-
PHF2 regulates homology-directed DNA repair by controlling the resection of DNA double strand breaksbioRxiv - Molecular Biology 2019Quote: ... Rad51 by Invitrogen and CtIP from Active Motif.
-
bioRxiv - Cancer Biology 2019Quote: ... overnight at 4 °C or H3K27ac (Active motif; Catalog no: 39133). The purified ChiP DNA was used to generate sequencing libraries using Hapa Hyper prep kit from Kapa Biosystems ...
-
bioRxiv - Plant Biology 2019Quote: ... ChIP-seq assays were conducted with antibodies against H2A.Z (39647, Active Motif), H3K4me3 (04-745 ...
-
bioRxiv - Genomics 2019Quote: ... the data were normalized according to the algorithm developed by Active Motif, Inc ...
-
bioRxiv - Genomics 2019Quote: ... The ChIP-validated antibodies H3 pan-acetyl (Active Motif, cat # 39139) and Cas9 antibody (mAb ...
-
bioRxiv - Genomics 2019Quote: ... The ChIP-qPCR assays were carried out on 30 μg of cross-linked chromatin according to the HistonePath™ (Active Motif) ChIP-qPCR protocol ...
-
bioRxiv - Bioengineering 2019Quote: ... the sample was washed with MAXwash Washing Medium (Active Motif, catalog no. 15254) at RT 4 times ...
-
bioRxiv - Bioengineering 2019Quote: ... for 4-6 hours at room temperature and incubated in MAXbind Staining Medium (Active Motif, catalog no. 15251) containing primary antibodies at a concentration of 10 μg/mL overnight at 4□C ...
-
bioRxiv - Bioengineering 2019Quote: ... The sample was first blocked with MAXblock Blocking Medium (Active Motif, catalog no. 15252) for 4-6 hours at room temperature and incubated in MAXbind Staining Medium (Active Motif ...
-
bioRxiv - Systems Biology 2019Quote: ... Permeabilized cells were incubated overnight at 4°C with 5ug of anti-H3K27me3 (Active Motif 39156) and then washed before incubating with protein A-MNase fusion protein (a gift from S ...
-
bioRxiv - Neuroscience 2019Quote: ... and nuclear histone (H3K27Ac, 39133, Active Motif) which were used to visualize cell populations in the immunocytochemical analysis ...
-
bioRxiv - Neuroscience 2019Quote: The SOX2 primary antibody (39823, Active Motif, Carlsbad, CA, USA) has been validated for immunohistochemical analysis in our previous study (Hoefflin and Carter ...
-
bioRxiv - Neuroscience 2019Quote: ... and IgG as a control (ChIP-IT Control Kit, Active Motif). Use of the CTCF antibody in ChIP analysis of brain chromatin was initially verified using a known CTCF target sequence in the Igf2 gene (Ling et al ...
-
bioRxiv - Neuroscience 2019Quote: ... histone H3K27ac (39133, Active Motif), LHX1 (C6 ...
-
bioRxiv - Neuroscience 2019Quote: ... ChIP assays were then conducted using antisera to CTCF (61311, Active Motif), histone H3K27ac (39133 ...
-
bioRxiv - Neuroscience 2019Quote: ... The ChIP-IT Express kit (Active Motif, Carlsbad, CA, USA) was used as described (Davies et al ...