Labshake search
Citations for Active Motif :
1351 - 1400 of 1695 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... rabbit antibody to H3K9me3 (1:500; 39161; Active Motif, Palo Alto, CA, USA), rabbit antibody to H3K9ac (1:1000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Pol II Ser2 (Active Motif: 91115), CDK12 (Bethyl ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA Pol II (Active Motif: 91151), RNA Pol II Ser2 (Active Motif ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA pol II Ser2 (Active Motif: 91115) at 1:1000 ...
-
bioRxiv - Cell Biology 2021Quote: ... H2AP.T120 (Active Motif Cat#61195 Lot#31511001), BUB1 (GeneTex Cat#GTx30097 Lot#821701160 ...
-
bioRxiv - Cell Biology 2021Quote: ... ChIP kit was purchased from Active Motif (#53008, Carlsbad, CA), and the processing was followed according to the manual ...
-
bioRxiv - Genomics 2021Quote: ... and H3K36me3 (Active Motif, Carlsbad, CA, USA) were included in this study ...
-
bioRxiv - Genomics 2021Quote: ... and 1 µl of H3K27ac antibody (Active Motif, 39085) were added to the supernatant and rotated at 4°C overnight ...
-
bioRxiv - Genomics 2021Quote: ... H3K9me3 (Active Motif 39162), CENP-A (Aaron Straight ...
-
bioRxiv - Genomics 2021Quote: ... mouse anti-H3 antibody (MABI 0301, Active Motif), or rabbit or mouse IgG (Invitrogen ...
-
bioRxiv - Genomics 2021Quote: ... and H3K27ac (Active Motif, 39135). Beads were washed three times each with wash buffer I (20 mM Tris/HCl ...
-
bioRxiv - Genomics 2021Quote: ... The resulting sheared chromatin fragments in a size range between 200 to 500 base pairs were incubated with H3K27me3 (Millipore #07-473,1:1000; Active Motif #39160, 1:500) or H4K20me3 (Abcam ...
-
bioRxiv - Genomics 2021Quote: ... Anti-Histone H3K27ac (Active Motif, 39133), Anti-Histone H3K4me1 (Active Motif ...
-
bioRxiv - Genomics 2021Quote: ... Anti-Histone H3K4me1 (Active Motif, 39297)
-
bioRxiv - Genomics 2021Quote: ... Chromatin was sonicated for 3 minutes with a probe sonicator (Active Motif). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ATAC-seq was performed in biological duplicate using the ATAC-Seq Kit (Active Motif, catalog No.53150). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2μg spike-in antibody (61686, Active Motif (lot 34216004)) being included in each IP reaction ...
-
bioRxiv - Molecular Biology 2021Quote: Chromatin was prepared from flash-frozen liver tissue using the Active Motif ChIP-IT High Sensitivity kit (Active Motif), employing a modified protocol described in (47) ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... qPCR was performed using human positive and negative control qPCR primer sets from Active Motif (Supplementary Table S6). Furthermore ...
-
bioRxiv - Molecular Biology 2021Quote: ... H3K9me1 (39681, Active Motif), H3K9me2 (05-1249 ...
-
bioRxiv - Molecular Biology 2021Quote: ... H3K27ac (39133, Active Motif), CTCF (61312 ...
-
bioRxiv - Neuroscience 2021Quote: ... the Next Gen DNA Library Kit (Active Motif, Cat# 53216) and Next Gen Indexing Kit (Active Motif ...
-
bioRxiv - Neuroscience 2021Quote: ... and Next Gen Indexing Kit (Active Motif, Cat# 53264) were used according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: The rest of the ChIP experiment (beginning from “Protein G Agarose Bead Preparation”) was carried out using the reagents and protocols from the Low Cell ChIP-Seq Kit (Active Motif, 53084). In brief ...
-
bioRxiv - Biophysics 2021Quote: ... rabbit anti-H3K9me2 (1:1000; #39239, Active Motif), rabbit anti-H3K9me3 (1:1000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Immunoprecipitation and elution were performed using the ChIP-IT High Sensitivity kit (Active Motif #53040) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1:500 (39787, Active Motif), anti-Calnexin ...
-
bioRxiv - Microbiology 2020Quote: ... Chromatin immunoprecipitation was performed using the ChIP-IT Express Enzymatic kit according to the manufacturer’s directions (Active Motif). DNA was enzymatically sheared for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... and primers targeting the Chr12 gene desert (Active Motif) or IFI44L promoter (forward primer = 5’ TTTCATGCCTGCCTACATAC 3’ ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP antibodies included mouse IgG (Active Motif), rabbit anti-FLAG (Cell Signaling ...
-
bioRxiv - Microbiology 2020Quote: ... and analyzed using the ChIP-IT qPCR Analysis kit (Active Motif).
-
bioRxiv - Molecular Biology 2020Quote: ... ChIP assays were performed according to the protocol of ChIP-IT Express Enzymatic kit (Active Motif) using ChIP-grade antibody against V5 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... blocked with MAXblock medium (Active Motif) and stained with antibodies against pH2AX (1:500 ...
-
bioRxiv - Molecular Biology 2020Quote: ... TET1 (Active Motif) and IgG as a control (Santa Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2020Quote: ... mouse anti-lamin-A/C (1:5000, Active Motif, #39287), rabbit anti-Emerin (1:5000 ...
-
bioRxiv - Cell Biology 2020Quote: Controls and bleomycin-injured MLE12 cells were lysed in ice-cold buffer (PBS, 0.05% Tween 20, pH 7.4) containing protease inhibitors (Active motif, 37491) and phosphatase inhibitor (Active motif ...
-
bioRxiv - Cell Biology 2020Quote: ... and phosphatase inhibitor (Active motif, 37493). After centrifugation (14,000 x g ...
-
bioRxiv - Cell Biology 2020Quote: ... Fibroblast cell nuclear fraction was extracted using a commercially available kit (Active motif, 40010) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... and nuclear extracts were isolated using the reagents and protocol provided in the Active Motif Nuclear Extract Kit (Active Motif). IL-13 effects on NFκB p52 DNA binding was evaluated using the TransAM NFκB Transcription Factor Assay Kit (Active Motif) ...
-
bioRxiv - Cell Biology 2020Quote: ... 24 hour post transfection chromatin immunoprecipitation assay was performed with a commercial kit (ChIP-IT enzymatic kit, Active Motif_Cat# 53006) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... α-H3K9ac (Active Motif 39137), α-H3K27ac (Abcam #ab4729) ...
-
bioRxiv - Cell Biology 2020Quote: ... α-H3K36me3 (Active Motif #61101), α-H3K9ac (Active Motif 39137) ...
-
bioRxiv - Cell Biology 2020Quote: ... Antibodies used were as follows: rabbit α-H3K9me3 (Active Motif, Carlsbad, CA #39161), rabbit α-SMC2 and α-SMC3 (from Ana Losada) ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked with MaxBlock blocking medium (Active Motif) containing 0.1% Tween-20 for 2 hours at RT ...
-
bioRxiv - Cell Biology 2020Quote: ... Magnetic beads (Active Motif) were then washed once with 1x PBS-Tween and combined with the antibody-lysate mixture ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were processed via the ChIP-IT High Sensitivity kit (Active motif) as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Histones were purified from cells by growing macrophages to a density of 3×107 (Active Motif - 40025). Histone H3K27me3 conversion was measured using the Active Motif kit (Epiquik Histone Methyltransferase activity assay kit (P-3005).
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-H2ApT120 (Active Motif cat#39391, 1:1000); Sheep anti-Bub3 (SB3.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-H2ApT120 (Active Motif cat#3939, 1:1000); sheep anti-Sgo1 (1:1000) ...
-
bioRxiv - Cell Biology 2020Quote: ... was used to detect the construct and the anti-H3 C terminus (Active Motif, Cat#39052) as a control.