Labshake search
Citations for PerkinElmer :
351 - 400 of 468 citations for Neuronal acetylcholine receptor subunit alpha 5 NACHRA5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... In situ hybridization using nitro-blue tetrazolium and 5-bromo-4-chloro-3′-indolyphosphate and double color in situ hybridization using TSA Plus (PerkinElmer) were performed as previously described (Yamagata et al.,1999 ...
-
bioRxiv - Microbiology 2021Quote: ... and fluorescence at 355 nm excitation and 460 nm emission was monitored every 5 minutes for 50 minutes using an Envision plate reader (PerkinElmer). Rate of substrate cleavage was determined using linear regression of the raw data values obtained during the time course ...
-
bioRxiv - Microbiology 2022Quote: ... was phosphorylated in vitro with His-MBP-PknBMtb at 0.015 μg/μl for 30 minutes at room temperature with 0.15μCi/μl ATP [γ-32P] (5×10-8 μmol) (3000Ci/mmol, 10mCi/ml, PerkinElmer BLU002A250UC) and 2mM MnCl2 in buffer (50mM Tris ...
-
bioRxiv - Neuroscience 2022Quote: ... Nifene or nicotine respectively for 5 min followed by addition of 2.5 nM [125I]-epibatidine ([125I]Epb) (2200 Ci/mmol; Perkin Elmer) and incubation for 20 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10-15 minutes later for 60 seconds ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mice were injected IP with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum imager (PerkinElmer) 10 minutes later ...
-
bioRxiv - Cancer Biology 2022Quote: ... in 100-µL sterile PBS were injected into the left cardiac ventricle of female 5-week-old NSG mice as described previously (50) and in vivo imaging was performed (IVIS Spectrum, PerkinElmer) immediately to verify widespread seeding of tumor cells ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 and 6 hr later cells were labeled for 5 min with 1 mCi/ml 35S Protein Labeling Mix (PerkinElmer). Lysates from 25-ml culture triplicate samples were analyzed by SDS-PAGE and autoradiography.
-
bioRxiv - Molecular Biology 2020Quote: ... with the confocal setting at 40X magnification at 37°C and 5% CO2 and analyzed with Columbus Image Analysis System (PerkinElmer). Each well was excited with 425 nm light and emissions detected at 434-515 nm for CFP and 500-550 nm for YFP ...
-
bioRxiv - Plant Biology 2021Quote: ... The pellet was resuspended in 100 μl PIB and transferred to a scintillation vial containing 5 ml Ultima Gold XR Scintillation liquid (PerkinElmer). Radioactivity for each vial was measured by liquid scintillation spectrometry.
-
bioRxiv - Cancer Biology 2020Quote: ... The filters were washed with 5 ml wash buffer and counted using a liquid scintillation counter (Wallac 1450 MicroBeta Trilux, PerkinElmer). Exchange reactions with GST-Rab35 on glutathione-Sepharose beads were performed in the presence or absence of Arf5 ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were grown for imaging using standard conditions and imaged in low fluorescence medium containing 5 µg/ml Dextran Alexa Fluor 647 on an Opera Phenix (PerkinElmer) automated system as described above.
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Biochemistry 2020Quote: ... was incubated with 5 μL of biotinylated peptides at 100 nM for 30 min at room temperature in the epigenetics assay buffer (PerkinElmer AL008 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Emission intensity was recorded for 5 min using 460 nm and 530 nm filters on the EnVision or Victor X Light plate reader (PerkinElmer). Next ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Reactions were incubated at 25 °C for 10mins followed by addition of 5 μCi of [γ-32P] ATP(Perkin Elmer). Reactions were incubated for additional 30 mins at 37 °C and were stopped using 3X Laemmli buffer ...
-
bioRxiv - Cancer Biology 2021Quote: 4T1 cells were cultured for 6 h in RPMI medium containing 0.4 μCi ml−1 [5-3H]D-glucose (Perkin Elmer) after which the supernatant was transferred into glass vials sealed with rubber stoppers ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and incubated with TSA Plus Fluorescein (PerkinElmer) according to the manual at RT for 3-15 minutes (3-5 min in H ...
-
bioRxiv - Genomics 2022Quote: ... the slides were washed three times in 1x TNT at RT for 5 minutes each and the amplification steps were repeated using anti-DNP-HRP Conjugate (PerkinElmer) and TSA Plus Cyanine 3 (PerkinElmer) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 0.05□μl of 5□mM stock compounds in DMSO were dispensed into assay microplates with a Janus 384 MDT NanoHead (PerkinElmer). Final concentration of the screening compounds in the assay was 16LμM ...
-
bioRxiv - Neuroscience 2023Quote: ... Live cell imaging was performed at 37°C in 5% CO2 for 24 hours using the Opera Phenix High Content Screening System (PerkinElmer). Acquired images were analyzed by using the Harmony software (PerkinElmer).
-
bioRxiv - Bioengineering 2023Quote: ... The plasma was obtained by centrifugation at 500 g for 5 min and measured for MFI using IVIS (PerkinElmer, USA).
-
bioRxiv - Microbiology 2023Quote: ... Samples were mixed with the DNA absorption solution (for one sample: 50 uL 5 M NaCl, 15 ul magnetic beads (GMG-252-A-100mL – PerkinElmer), 250 uL 7.8 M guanidium chloride ...
-
bioRxiv - Immunology 2023Quote: ... Tumor growth in live mouse was monitored every 5 days by bioluminescence imaging (BLI) using IVIS Spectrum In Vivo Imaging System (PerkinElmer) after 10mins intraperitoneally injection of 150mg/Kg D-luciferin ...
-
bioRxiv - Immunology 2024Quote: ... the plates were centrifuged at 500 × g for 5 min and 20 µl of supernatant from each well was transferred to a 96 well DELFIA Yellow Plate (PerkinElmer) and combined with 200 µl of europium ...
-
bioRxiv - Cancer Biology 2023Quote: ... Each protein (5 µL) was mixed and incubated for 1 h in a 384-well AlphaPlate (PerkinElmer, Waltham, MA, USA). After diluting Alpha Screen Protein A Acceptor Beads (PerkinElmer ...
-
bioRxiv - Immunology 2023Quote: ... Successful tumor implantation was confirmed on day 5 by luminescence detection using an IVIS® Lumina S5 Imaging System (PerkinElmer). Animals were then randomized and received an intracranial intratumoral administration of 1×106 anti-PTPRZ1 RNA CAR-T cells or Mock EP T cells in 2 μL of HBSS on day 7 ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... the membranes were again washed three times for 5 min with TBS-T20 and the blots developed with Western lightning solution (Perkin Elmer) with a Fuji LAS-4000 imager (GE Healthcare).
-
bioRxiv - Plant Biology 2019Quote: ... the bottom piece (0-0.5 cm) was discarded and the remaining pieces were placed separately into 5 mL Ultima Gold™ (PerkinElmer, # 6013329) for overnight maceration ...
-
bioRxiv - Microbiology 2019Quote: ... Collected cell batches on polycarbonate filters were directly transferred into 6 ml scintillation vials and mixed with 5 ml UltimaGold XR (Perkin Elmer) scintillation cocktail ...
-
bioRxiv - Microbiology 2021Quote: ... Oligonucleotide probes (listed in Supplementary Table S2) were 5′ 32P-end labeled with 0.3 mCi of γ-32P ATP (Perkin Elmer) by incubating with 10 U of T4 polynucleotide kinase (New England Biolabs ...
-
bioRxiv - Biophysics 2021Quote: ... Validation assays for 5-HT5AR-Gi1 expression were performed as described above using 10nM [3H]-LSD (82.4 Ci/mmol, PerkinElmer, Waltham, MA).
-
bioRxiv - Cancer Biology 2020Quote: ... Probes were prepared by random priming of corresponding PCR products (5’ and GFP templates) in the presence of [αP32]CTP (PerkinElmer BLU513H100UC). Unincorporated nucleotides were removed using a Sephadex G-50 column (GE Healthcare 28-9034-08) ...
-
bioRxiv - Cell Biology 2021Quote: ... was monitored every 5 min for 2 h at 37°C using a fluorescent plate reader (EnSpire Multimode Plate Reader, Perkin Elmer). Samples were assayed in technical triplicates and in biological replicates as indicated in the figure legend.
-
bioRxiv - Neuroscience 2020Quote: ... the solvent was evaporated under N2 flow and resuspended with 500 mL of chloroform/methanol (2:1v/ v) and half the suspension was placed separately into vials with 5 mL of scintillation solution (Ultima Gold XR, Perkin Elmer). Levels of radioactivity were measured on the Liquid Scintillation Analyzer ...
-
bioRxiv - Microbiology 2021Quote: ... Aliquots of 100 μL were transferred daily (up to 10 days post dormancy induction) to a 96 well plate where 5 μCi 3H-hypoxanthine (Perkin Elmer), 5 μCi 3H-adenosine (Perkin Elmer) ...
-
bioRxiv - Microbiology 2020Quote: ... CoV-infected cells and control mock-infected cells were incubated for different periods of time with tritiated uridine ([5-3H]uridine, 1 mCi/ml, Perkin Elmer), which was mixed in a 1:1 ratio with double-concentrated medium ...
-
bioRxiv - Cell Biology 2020Quote: ... Glass fibre prefilters were air dried for 5 min and the amount of 35S-labeled methionine was analyzed with 5 ml liquid scintillation cocktail Ultima Gold™ (6013329, PerkinElmer) by Liquid Scintilation Analyzer Tri-Carb 4910 TR (PerkinElmer).
-
bioRxiv - Genomics 2020Quote: ... washing (3 times 5 min in TNT) and 8 min incubation using Fluorescein Tyramide (for pimonidazole NEL701A001KT, perkin Elmer) or Cy3 (NEL704A001KT, Perkin Elmer) 1:50 in amplification diluent.
-
bioRxiv - Cell Biology 2022Quote: ... An equal volume of cell culture media and esterase substrate (100 μM in esterase assay media at pH 5) was transferred to a black walled clear bottomed plate (Perkin Elmer) and fluorescence was measured after 1 h.
-
bioRxiv - Microbiology 2020Quote: ... cooled to room temp (5 min) and absorbance was read at 432 nm on a Wallac 1420 VICTOR Multilabel reader (Perkin Elmer). Formaldehyde standards were prepared daily from 1 M formaldehyde stock solutions and a standard curve was alongside all sample measurements.
-
bioRxiv - Bioengineering 2020Quote: ... Lungs were incubated for 5 minutes and then placed onto black paper and imaged with an IVIS Spectrum CT (Perkin Elmer). Lung luminescence was then quantified using Living Image software (Perkin Elmer).
-
bioRxiv - Immunology 2019Quote: ... FRET imaging was performed from 30 minutes post injury for 5 hours using a 20x objective lens on an UltraVIEWVoX spinning disc confocal laser imaging system (Perkin Elmer) with acquisition every 2 minutes ...
-
bioRxiv - Cell Biology 2019Quote: ... GST-Aq-NF-κB or GST-Aq-NF-κB-ALA C-terminal peptides and 5 μCi [γ-32P] ATP (Perkin Elmer) in kinase reaction buffer (25 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... Probes corresponding to the 5’ and 3’ flanks of the laeA gene in each strain were labeled using [a32P] dCTP (PerkinElmer, USA) following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... was incubated with oligonucleotide probes (0.01 pmol-10 fmol) 5’-radiolabeled with [y-32P]ATP (5000 Ci/mmol; PerkinElmer Life Science). Different dsDNA structures were prepared by annealing the radiolabeled sense oligonucleotides with a twofold excess of unlabeled complementary oligonucleotide and purified on non-denaturing polyacrylamide gels ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were pre-treated with anisomycin (100 ug/ml) for 5 min to inhibit cytoplasmic translation then pulsed with 200 uCi/ml 35S Met-Cys (EasyTag-Perkin Elmer). In chase experiments ...
-
bioRxiv - Biochemistry 2021Quote: ... Thirty μL of tissue homogenate supernatant were mixed with 370 μL of the oxidation reaction mixture containing 7% BSA/5 mM palmitate/0.01 μCi/μL 14C-palmitate (PerkinElmer, Waltham, MA) and incubated at 37 °C for 30 min ...