Labshake search
Citations for PerkinElmer :
201 - 250 of 1277 citations for 7 Benzyl 4 chloro 5 6 7 8 tetrahydropyrido 3 4 d pyrimidin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the free-floating sections were incubated overnight at 4°C with Streptavidin-Texas Red (1:400, NEL721001EA PerkinElmer). Finally ...
-
bioRxiv - Microbiology 2021Quote: KN99α was grown as described above in MM supplemented with 2 μCi/ml 3H-NE and 1.0 mM unlabeled NE or a mixture of 1.0 mM unlabeled NE and DA or with 4 μCi/mL (0.0001 mM) Dihydroxyphenylethylamine 3,4-[Ring-2,5,6-3H] (3H-DA, Perkin Elmer NET673250UC) and 1.0 mM unlabeled DA or 1.0 mM unlabeled NE and DA for 10 d at 30°C ...
-
bioRxiv - Immunology 2022Quote: ... Prior to the immunization all mice were anesthetized by isoflurane inhalation with RAS-4 Rodent Anesthesia System (PerkinElmer). Mice were euthanized on day 28 for terminal blood collection and spleens were harvested for cellular assays ...
-
bioRxiv - Plant Biology 2022Quote: ... dissolved in 0.1% nitric acid and 4 mL Optima Gold XR scintillant (Perkin Elmer, Glen Waverley, VIC, Australia) was added prior to counting for two minutes using a Liquid Scintillation Counter (LS6500 ...
-
bioRxiv - Cell Biology 2023Quote: ... Live imaging was done 4-8h later using a spinning disk confocal microscope (Perkin Elmer Ultra View ERS) equipped with a heating chamber (37°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... or 4 µl of suspension was carefully distributed in the centre of an optical-bottom 96-well (PerkinElmer) for immunofluorescence experiments ...
-
bioRxiv - Molecular Biology 2023Quote: ... filters were placed into scintillation vials with 4 mL Emulsifier-safe liquid scintillation fluid (Perkin Elmer, Waltham, MA) and analyzed using a liquid scintillation counter ...
-
bioRxiv - Cell Biology 2023Quote: ... the rabbit reticulocyte lysate master mix was supplemented with EasyTag L-35-Methionine (4% final reaction volume; PerkinElmer). Canine rough pancreatic microsomes (cRMs ...
-
bioRxiv - Synthetic Biology 2024Quote: ... cells were fixed in 4% PFA and imaged with the Opera Phenix High Content Screening System (Perkin Elmer), acquiring at least 10 images per well ...
-
bioRxiv - Microbiology 2021Quote: ... The volumes of internalised DNA in GFP expressing bacteria were estimated by 3-D image analysis performed using Volocity software (Perkin Elmer, Waltham, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... Mice were anesthetized at 37 °C with inhaled isoflurane in an induction chamber for 5 min and received an intraperitoneal injection of luciferin (150 mL, RediJect D-Luciferin Ultra Bioluminescent Substrate, PerkinElmer, 770505). Bioluminescence images were taken 13 minutes after injection ...
-
bioRxiv - Plant Biology 2021Quote: ... leaf discs excised from the transformed leaves were incubated with 200 µM D-luciferin (Wako) for 2 h in white 24-well plates (PerkinElmer). Then ...
-
bioRxiv - Physiology 2020Quote: On the fifth day of EOS or PBS treatment 3H-2-deoxy-D-glucose (2DG; 10uCi/mouse; PerkinElmer, Waltham, MA) was given to 4 hour fasted individually housed mice ...
-
bioRxiv - Cancer Biology 2023Quote: ... Luciferase measurements were taken every other day beginning from day 2 (the day after the injection) – mice were anaesthetised (isoflurane inhalation) and subcutaneously injected with Xenolight D-luciferin substrate (PerkinElmer). Mice were imaged after 5min using the IVIS Lumina II (Caliper Life Sciences) ...
-
bioRxiv - Physiology 2024Quote: ... or 120 nM of insulin in fresh serum-starvation medium for 30 min before adding 2 μL.mL-1 D-[14C(U)] glucose (NEC042B005MC; Perkin Elmer) for a further 90 min ...
-
bioRxiv - Cell Biology 2021Quote: ... 500nl of 2 µM siRNAs (20nM final concentration) were distributed on 6 different 384-well imaging plates (CellCarrier Ultra, Perkin Elmer), as described in Table 3 ...
-
bioRxiv - Immunology 2021Quote: ... brain and testis tissue samples from hACE2 transgenic mice challenged intranasally with SARS-CoV-2-nLuc (1 x 105 FFU; 6 dpi) were imaged after necropsy using bioluminescence imaging (IVIS, Perkin Elmer), pruned to isolate regions with high nLuc activity and immediately pre-fixed with 3 % glutaraldehyde ...
-
bioRxiv - Developmental Biology 2020Quote: D-Luciferin (Perkin Elmer) was dissolved in H20 at 30 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... D-luciferin (Perkin Elmer) was administered by IP injection ...
-
bioRxiv - Neuroscience 2023Quote: ... D-Luciferin (Perkin Elmer) was diluted to 3 mg/100 µL in normal saline and 0.6 mg of D-Luciferin was administrated intraperitoneally ...
-
bioRxiv - Cancer Biology 2022Quote: ... D-luciferin (Perkin Elmer) was added to a final concentration of 150 μL/mL and luciferase signal was measured using the Envision® 2105 Multimode Plate Reader (Perkin Elmer) ...
-
bioRxiv - Cell Biology 2023Quote: ... D-Luciferin (Perkin Elmer) was diluted in ESC medium to a final concentration of 150 μg/mL and added to mESCs 10 minutes prior to imaging ...
-
bioRxiv - Molecular Biology 2021Quote: ... 50 μL/well) was captured overnight at 4°C onto high-protein-binding ELISA plates (Spectraplate 96HB, Perkin Elmer). Plates were washed in PBS/Tween (0.05% v/v ...
-
bioRxiv - Microbiology 2022Quote: ... one ml of culture was labelled for 4 min at 30 °C using 30 μCi γ-[32P]ATP (PerkinElmer). Samples were incubated with 6% sucrose ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 μL/well of cell culture supernatant was taken out and dispensed into OptiPlate-384 microplates (PerkinElmer, cat #: 6007290) that was pre-filled by 12 μL/well PBS by an EL406 ...
-
bioRxiv - Immunology 2023Quote: ... uptake inhibition and degradation were determined in M[0] and M[IL-4] using 3H-choline chloride (Perkin Elmer) as previously described [4].
-
bioRxiv - Cell Biology 2022Quote: Candidate small RNA sequences were identified from raw sequence data using cutadapt (ver. 2.8)21 with parameters “-u -4 -a A(10)” as recommended by PerkinElmer NextFlex Combo-Seq kit ...
-
bioRxiv - Neuroscience 2020Quote: ... The receptor autoradiography procedure was performed using a linear V1a-R antagonist [125I]-d(CH2)5(Tyr[Me])-AVP (Perkin Elmer, USA) or a linear OXTR antagonist [125I]-d(CH2)5[Tyr(Me)2-Tyr-Nh2]9-OVT (Perkin Elmer ...
-
bioRxiv - Physiology 2021Quote: ... a longer time was required to achieve steady state) a single bolus of 12 μCi of [1-14C]-2-deoxy-D-glucose (Perkin Elmer) in 96 μl of saline was administered ...
-
bioRxiv - Physiology 2020Quote: On the fifth day of EOS or PBS treatment 3H-2-deoxy-D-glucose (2DG; 10 uCi/mouse; PerkinElmer, Waltham, MA) was given to 4-hour fasted individually housed mice ...
-
bioRxiv - Physiology 2023Quote: ... the animals were fasted overnight and a bolus of 2-deoxy-D-[1,2-3H]-glucose (1mC/ml; specific activity: 20Ci/mmol; PerkinElmer, Madrid, Spain) mixed with glucose (100µCi/kg body weight ...
-
Multiplexed single-cell transcriptomic analysis of normal and impaired lung development in the mousebioRxiv - Cell Biology 2019Quote: ... TSA Plus fluorophores fluorescein Cyanine 3 (1:1500 dilution) and Cyanine 5 (1:3000 dilution) (Perkin Elmer, Waltham, MA, USA) were used for signal detection ...
-
bioRxiv - Cancer Biology 2022Quote: ... the membranes were washed 5 min 3 times and developed using enhanced chemiluminiscence reagent (Western Lightning Plus-ECL; Perkin Elmer). The following primary antibodies were used ...
-
bioRxiv - Molecular Biology 2024Quote: 3 pmol of a 50nt oligonucleotide (VP683, TCGAGCTGCGCAAGGATAGGTCGAATTTTCTCATTTTCCGCCAGCAGTCC) was 5’ radiolabelled using 3.3 pmol of γ-32P-ATP (Perkin Elmer) and 10 units of PNK (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a Chemagic Prime 8 system (PerkinElmer). 290 μl viral sample were mixed with 10 μl extraction control sample and 300 μl lysis buffer ...
-
bioRxiv - Cell Biology 2021Quote: ... NEXTflex-6 barcoded adapters (PerkinElmer) were ligated using 1 μl Quick T4 DNA Ligase (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... ORO was measured by extracting lipids with a petrol ether/isopropanol mixture (3:2) and quantified for their absorbance at 490 nm for 0.1 s with Victor Spectrophotometer (PerkinElmer). Standard curve was applied and quantification was expressed in µg of pure ORO powder.
-
bioRxiv - Immunology 2024Quote: ... Tumor progression was subsequently monitored every 2-3 days using caliper measurement and the IVIS Spectrum imaging system (PerkinElmer) to measure bioluminescent signal after intraperitoneal administration of 0.15 mg of luciferin substrate per gram of body weight (PerkinElmer 122799) ...
-
bioRxiv - Biophysics 2021Quote: ... Cell fixation was performed 24h after transfection using 4% formaldehyde and cellular imaging was performed using an Operetta CLS (PerkinElmer). Three individual plate preparations were used as independent experiments for statistical significance (n=3) ...
-
bioRxiv - Biophysics 2022Quote: ... incubated for 4 h at 37°C and fluorescent signal intensity was quantified using the EnSpire Multimode Plate Reader (PerkinElmer) at excitation and emission wavelengths of 540 and 612 nm respectively.
-
bioRxiv - Molecular Biology 2020Quote: ... The protein pellet was then re-suspended in PBS and incubated in 4 mL of scintillation fluid (Insta-Gel Plus, PerkinElmer) for 24 h (to homogenize the samples ...
-
bioRxiv - Neuroscience 2020Quote: ... TR-FRET readout was performed after 1 h incubation at 4°C using an EnVision 2105 Multimode Plate Reader (PerkinElmer) with previously defined measurement parameters53 ...
-
bioRxiv - Biophysics 2020Quote: ... separated free and bound radioligand and the radioactivity on each filter determined by the addition of 4 mL of Ultima Gold XR liquid scintillant (PerkinElmer), overnight incubation at room temperature and count using a Beckman Coulter LS 6500 Multi-purpose scintillation counter (Beckman Coulter Inc. ...
-
bioRxiv - Neuroscience 2022Quote: ... 022-105721-00321-0001, POLATOM, as a marker for K+ transport, and 4 μCi ml-1 3H-mannitol as an extracellular marker, PerkinElmer) for 2min (influx ...
-
bioRxiv - Neuroscience 2022Quote: ... To quantify α1-3;5GABAAR79 sections were incubated for 60 minutes at 4°C in 1nM [3H]flumazenil (Perkin Elmer, NET757001MC), or in 1nM [3H]flumazenil with 10 µM flunitrazepam (Sigma Aldrich ...
-
bioRxiv - Molecular Biology 2021Quote: HDL-sRNA libraries were generated using the NEXTFlex Small RNA-Seq Kit v3 with 1:4 adapter dilution and 22 PCR cycles (PerkinElmer). Following PCR amplification ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were cultured in α-MEM containing media containing 2μM Glutamine and 4 mCi/mL L-[3,4-3H(N)]-Glutamine (PerkinElmer, NET551250UC). GLS activity was terminated by washing cells with ice cold HBSS for three times followed by scaping cells with 1 mL ice cold milliQ water ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Aerrane (Isoflurane, Baxter) inhalation was performed for anesthesia using the RAS-4 Rodent Anesthesia System (Perkin Elmer, Waltham, MA, USA) for experiments with IVIS Spectrum CT living imaging system (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... was next added and incubated with the mixture at 4 °C for 1 hour before the measurements performed on Envision Readers (PerkinElmer). The fluorescently-labeled m6A-containing mRNA was used to adjust the gain factor ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were washed with PBS and then stored in PBS at 4°C until imaged in the Opera Phenix (PerkinElmer) at 40x magnification and images analysed using a Harmony software to assess protein expression and morphology (see supplementary).