Labshake search
Citations for Qiagen :
251 - 300 of 5854 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Bioengineering 2023Quote: ... Primers for qRT-PCR were designed using the Primer Quest tool (Integrated DNA Technologies) and SYBR Green (Qiagen) was used as the DNA intercalating dye ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time quantitative RT-PCR was performed using the miScript SYBR Green PCR kit (Qiagen) and a ViiA 7 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2020Quote: ... Quantitative real-time PCR was performed with a Rotor-Gene Q RT-PCR machine (QIAGEN) using a KAPA SYBR FAST qPCR kit (Kapa Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Molecular Biology 2019Quote: ... Quantitative RT-PCR (qRT-PCR) experiments were carried out on a Rotor-gene Q (Qiagen) apparatus.
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative RT-PCR gene expression analysis was performed with QuantiFast SYBR Green PCR kit (Qiagen) using a StepOnePlus (Applied Biosystem) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Genetics 2022Quote: ... Quantitative RT-PCR was conducted in triplicate using a Quantitect SYBR Green PCR reagent (Qiagen) following manufacturer instructions on a Bio-Rad CFX96 Real-Time PCR system (Bio-Rad ...
-
bioRxiv - Bioengineering 2022Quote: ... Custom RT² Profiler PCR Arrays and SYBR® Green PCR Master Mix (Qiagen, Hilden, Germany) were used to detect expression of transcripts ...
-
bioRxiv - Molecular Biology 2019Quote: ... or gga-miR-429-3p mimics (Qiagen) using 0.65 μL of PolyJet™ (SL100688 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and has-miR-130b-5p (Qiagen, MIMAT0004680) were transiently expressed to induce senescence-like phenotype ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-has-miR-130b-3p (Qiagen, MIMAT0000691) and Ant-has-miR-130b-5p (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR reaction was carried out using the QuantiNova Kit Probe RT-PCR Kit (Qiagen, catalog #208354, Germany), using primers and probe described in Naveca et al ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR was performed using primers listed in Table S3 and QuantiNova SYBR Green PCR (Qiagen) or iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using SYBR Green QuantiTect Primer Assay (Qiagen) according to manufacturer’s instructions in a 7900HT Fast-Real Time PCR System Instrument (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... The ChIP primers were purchased from Qiagen (EpiTect ChIP PCR assay) and used for qPCR analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... QuantiNova SYBR Green PCR Kit and QuantiTECT primer assays (Qiagen, UK) were used ...
-
bioRxiv - Cell Biology 2021Quote: ... primers and PCR fragments was performed using CLC Main Workbench (Qiagen). Oligonucleotides were synthesised by Eurofins Genomics ...
-
bioRxiv - Cell Biology 2022Quote: ... AT2R qRT-PCR was performed using RT2 qPCR Primer Assay (Qiagen). AT2R ...
-
bioRxiv - Neuroscience 2021Quote: ... miR-67 (miR control) or empty vector at a ratio of 1:3 using a lipofection protocol (Effecten, Qiagen) and processed at DIV15 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... RT² SYBR Green ROX qPCR Mastermix and primers for Gapdh were purchased from Qiagen (Valencia, CA).
-
bioRxiv - Cancer Biology 2020Quote: Quantitative real-time PCR for stemness and differentiation genes was performed using primers purchased from Qiagen (QuantiTect primer assay). RNA was isolated from cells according to the manufacturer’s instructions using Trizol (Invitrogen) ...
-
bioRxiv - Physiology 2019Quote: ... Quantitative RT-PCR analysis was performed using custom designed 384-well RT2 PCR Profiler Arrays (Qiagen) and RT2 SYBR Green Mastermix (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was performed using the QuantiNova SYBR Green RT-PCR Kit (Qiagen, Valencia, CA). Results are expressed as the ratio of target mRNA to cyclophilin-A RNA levels and normalized to the levels in control islets ...
-
bioRxiv - Cell Biology 2021Quote: ... qRT-PCR was performed using the QuantiNova SYBR Green RT-PCR kit (Cat. No. 208154; Qiagen) and CT values were measured using the Rotor-Gene (Corbett ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using a Rotor-Gene Q 5plex HRM Platform (Qiagen). All reactions were performed on at least three biological and three technical replicates ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR was performed in technical replicates using QuantiFast SYBR Green RT-PCR Kit (Qiagen, # 204156) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using a Rotor-Gene Q 5plex HRM Platform (Qiagen). Each reaction was carried out in a total volume of 15 μL containing 2 μL of diluted cDNA (about 10 ng) ...
-
bioRxiv - Neuroscience 2023Quote: ... Real-time quantitative PCR was performed using QuantiNova® SYBR® Green RT-PCR Kit (Qiagen) according to the manuals on CFX Real-Time qPCR system (BioRad).
-
bioRxiv - Cancer Biology 2020Quote: ... and hsa-U6 snRNA (U6) were purchased from Qiagen (Qiagen, Valencia, CA) and qPCR was performed using the Qiagen miSCRIPT SYBR® Green PCR kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Positive methylated and positive unmethylated controls (EpiTect PCR Control DNA Set Qiagen, Hilden, Germany) were included.
-
bioRxiv - Microbiology 2021Quote: ... cDNA Synthesis was performed with OneStep RT-PCR Kit (Qiagen, Germany) and NS specific primers ...
-
bioRxiv - Microbiology 2019Quote: ... performed using QuantiTect SYBR® Green RT-PCR Kit reagents (Qiagen) on a StepOne Real-Time PCR instrument (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real-time RT-PCR was performed in the RotorGene system (Qiagen) using SYBR Green (Quanta 95072-012) ...
-
bioRxiv - Immunology 2022Quote: ... and quantitative RT-PCR performed using QuantiTect Reverse Transcription Kit (Qiagen) and Luna® Universal RT-PCR Kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the QIAGEN One-Step RT-PCR Kit (QIAGEN, Hilden, Germany) in 50 μl reactions containing 10 μl 5x QIAGEN OneStep RT-PCR Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNAs were synthesized using one-step RT-PCR kit (Qiagen; 205311). To amplify specific cDNAs ...
-
bioRxiv - Genomics 2020Quote: ... The QuantiFast Pathogen RT-PCR+IC Kit from Qiagen (Cat #: 211452) was used ...
-
bioRxiv - Genetics 2020Quote: ... cucurbitae36 using cDNA synthesized with the OneStep RT-PCR Kit (Qiagen) and the primer pair ZcMoY1F and ZcMoY1R (Supplementary Table 4 ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time RT-PCR was performed in the RotorGene system (Qiagen) using SYBR Green (Quanta 95072–012) ...
-
bioRxiv - Microbiology 2020Quote: ... 12.5 µL of 2X Quantitect Probe RT-PCR Master Mix (Qiagen), 0.5 µL of Superscript III Reverse Transcriptase (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... cDNA was synthesized using an RT kit for qRT-PCR (Qiagen) with a mixture of oligo dT and random primers ...
-
bioRxiv - Biochemistry 2019Quote: ... Real time RT-PCR was performed in the RotorGene system (Qiagen) using SYBR Green ...
-
bioRxiv - Microbiology 2020Quote: ... only modified by using the QuantiTect Probe RT-PCR Kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was synthesized and amplified using OneStep RT-PCR Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... which was performed using a QuantiTect Probe RT-PCR Kit (Qiagen) on the LightCycler 480 system (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... Overlapping amplicons were generated using the OneStep RT-PCR kit (Qiagen) with 5 μl of cDNA as a template ...