Labshake search
Citations for Qiagen :
151 - 200 of 5854 citations for hsa mir 320a RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... 100nM of miR-24-3p inhibitor (Anti-mmu-miR-24-3p, Qiagen, MIN0000219), 100nM of scrambled control (AllStars Negative Control siRNA Print ...
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe targeting the AIV matrix gene 36 were used to perform the quantitative RT-PCR (qRT-PCR) reaction by using the One-Step RT-PCR Kit (QIAGEN, Valencia, CA, USA) on a StepOne Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was done with miRCURY LNA RT Kit (Qiagen Cat. No. 339340), adding UniSp6 and cel-miR-39-3p RNA Spike-Ins (Qiagen Cat ...
-
bioRxiv - Cell Biology 2021Quote: ... random hexamer primers and reverse transcriptase QuantiTech RT Kit (Qiagen, Germantown, MD). Quantitative PCR was performed using the 7800HT (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Cell Biology 2019Quote: ... We then used the purified RNA samples for RT-PCR with the OneStep RT-PCR kit (cat# 210210, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Expression of the genes of interest was also confirmed using RT-PCR using the OneStep RT-PCR Kit (Qiagen) before the experiment was conducted ...
-
bioRxiv - Microbiology 2021Quote: ... and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen) and QuantStudio 5 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with 200 ng of extracted total RNA using a Qiagen OneStep RT-PCR Kit (Qiagen). The primers used were a forward primer (Hokkaido System Science ...
-
bioRxiv - Pathology 2020Quote: ... and the RT product was used for detection of miR-574-5p/3p and control RNA Snord68 using the miScript Primer Assay (Qiagen).
-
bioRxiv - Molecular Biology 2024Quote: miScript or miRCURY LNA Primer Assay was used to quantify the expression of miR-146a-5p (MS00003535 or YP00204688; Qiagen) in MIN6 cells or mouse pancreatic islets ...
-
bioRxiv - Developmental Biology 2022Quote: ... MiRNA-specific PCR primers were purchased from Qiagen (miR-98-5p ...
-
bioRxiv - Biophysics 2019Quote: ... The expression levels of miR-21 were quantified by qRT-PCR using miRCURY SYBR Green PCR Kit (QIAGEN, Venlo, The Netherlands). The results ...
-
bioRxiv - Cancer Biology 2023Quote: ... MiRs (61 plus 3 controls) were quantified on a custom PCR plate using the miRCURY LNA miR SYBR Green PCR Handbook (Qiagen, Germany). PCR (40 cycles ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2021Quote: ... evidence for successful ACE2 transduction was determined by real-time RT-PCR for mCherry mRNA with the OneStep RT-PCR kit (Qiagen). All samples for mCherry analysis were evaluated in one RT-PCR run ...
-
bioRxiv - Microbiology 2022Quote: ... primer sets were designed based on the Medaka-polished contigs and used for the RT-PCR amplification of regions of interest using the OneStep RT-PCR kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cells previously frozen in plates were thawed on ice and RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) protocol without modification ...
-
bioRxiv - Systems Biology 2019Quote: ... Clones were screened for translocations and the cDNA breakpoint determined by RT-PCR in a 96-well AB Veriti Fast Thermal Cycler using the Quantitect SYBR green RT-PCR kit (Qiagen) according to the manufacturers instructions with an annealing temperature of 56°C for 30 seconds ...
-
bioRxiv - Pathology 2021Quote: ... and from lung and/or heart tissues of seropositive rodents were used to amplify viral genome by RT- PCR using the One Step RT-PCR kit (QIAGEN) followed by nested or heminested PCRs (Taq Pegasus ...
-
bioRxiv - Immunology 2020Quote: ... The presence of the desired mutations in the viral genomes was verified by sanger sequencing of RT-PCR amplicons generated with the OneStep RT-PCR-kit (Qiagen) using LCMV WE GP-specific primers (GATTGCGCTTTCCTCTAGATC and TCAGCGTCTTTTCCAGATAG) ...
-
bioRxiv - Microbiology 2022Quote: ... villosum) (Table 1) were used in RT-PCR tests conducted in Slovenia using the OneStepTM RT-PCR kit (Qiagen, USA) as previously described (Rivarez et al ...
-
bioRxiv - Molecular Biology 2023Quote: Quantitative RT-PCR was performed using 30 ng of total RNA and QuantiTecT sYBR Green RT-PCR kit (Qiagen, 204243) according to the supplier’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transcript-specific primers were designed to span introns and the spcar3 mutation site and used in one-step RT-PCR reactions (210210, OneStep RT-PCR kit, Qiagen). Primer sequences for qRT-PCR are listed in Table 1 ...
-
bioRxiv - Pathology 2021Quote: ... the RT-qPCR reaction was prepared using the OneStep RT-PCR kit (Qiagen, Germany), adjusted to a volume of 12.5 µl with an internal control mastermix ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCRs and qPCRs were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) respectively with and without RT on a LightCycler 480 (Roche).
-
bioRxiv - Synthetic Biology 2022Quote: ... RT-PCR on the recovered mRNA was performed using the SensiScript RT Kit (Qiagen) with reverse primers that bound the 3’ end of each POI sequence ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed using the OneStep RT-PCR Kit (Qiagen) with only very few differences compared to the detection assay ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Immunology 2022Quote: ... cDNA was prepared using Quantitect RT- PCR (Qiagen) and RT Q-PCR was performed using the TaqMan Gene Expression Assay (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was prepared using Quantitect RT-PCR (Qiagen) and PCR performed with Brilliant III SYBRGreen on a Stratagene Mx3000 ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a RT² Profiler PCR Array (Qiagen, 330231), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Genetics 2022Quote: ... qRT-PCR was performed by QuantiTect SYBR Green PCR using miRNA- specific primers provided as miScript Universal primer and miScript Primer assay (QIAGEN) and Thermal Cycler Dice Real Time System (TAKARA).
-
bioRxiv - Developmental Biology 2021Quote: ... then cDNA synthesized using universal primers in the miRCURY LNA RT Kit (QIAGEN). Expression was quantified by qRT-PCR using the miRCURY LNA SYBR Green PCR Kit (QIAGEN ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by cDNA synthesis using random primers and the Omniscript RT kit (Qiagen). qPCR was performed using the MAXIMA SYBR Green kit (Thermo Scientific ...
-
Global genetic patterns reveal host tropism versus cross-taxon transmission of bat BetacoronavirusesbioRxiv - Evolutionary Biology 2020Quote: ... All RNA extracts were subjected to reverse transcription polymerase chain reaction (RT-PCR) using the one-step RT-PCR kit (Qiagen, USA) and PanCoV F2 (5’-AAR TTY TAY GGH GGY TGG-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... Three reactions per sample and per set of primers were prepared and processed using RotoGene (QIAGEN) with standard cycling.
-
bioRxiv - Neuroscience 2021Quote: ... Preamplification on cDNA was performed using the miScript PreAMP kit using the following primer sets (Qiagen): Hs miR146a_1 (M00003535) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR reactions were set up in triplicates using QuantiFast SYBR Green PCR Kit (Qiagen) and then carried out on the 7500 Real-Time PCR system (ThermoFisher ...
-
bioRxiv - Cancer Biology 2020Quote: RT-qPCR was carried out using QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) using the primer pairs detailed in Supplementary Table S11 ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers were purified by MinElute PCR Purification Kit (QIAGEN), to do the fusion PCRs ...
-
bioRxiv - Developmental Biology 2022Quote: ... We carried out qRT-PCR for miR-24-3p using the miRCURRY LNA kit as described (Qiagen). The primer sequences used for U6Sn ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed using the QuantiTech SYBR Green RT-PCR kit (Qiagen) per the manufacturer’s instructions ...
-
Integrative analysis of hexaploid wheat roots identifies signature components during iron starvationbioRxiv - Plant Biology 2019Quote: ... qRT-PCR was performed using QuantiTect SYBR Green RT-PCR mastermix (Qiagen, USA) with programs recommended by the manufacturer in the ABI 7700 sequence detector (Applied Biosystems ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR was conducted using QuantiTect SYBR Green PCR Kit (Qiagen; Germantown, MD) in 96 well PCR plates (Bio-Rad ...