Labshake search
Citations for Qiagen :
651 - 700 of 1607 citations for SARS CoV 2 Spike Glycoprotein S2 aa 1000 1200 His Tag E. coli since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... coli culture were harvested next morning to extract the plasmid library using the QIAfilter Plasmid Midi Kit (QIAGEN). Finally ...
-
bioRxiv - Microbiology 2023Quote: ... coli and the plasmid DNA was extracted using the pipetting Bio Robot Universal System (Qiagen cat. no. 9001094) and the QIAprep 96 plus BioRobot kit (Qiagen cat ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged CLEL6 precursor was purified from bacterial extracts by metal chelate affinity chromatography on Ni-NTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2019Quote: ... Input (3% of total binding reaction) and bound samples (50% of binding reaction) were subjected to SDS-PAGE followed by immunoblot analysis with His (Qiagen 34660) and GST (BioLegend MMS-112P ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Biochemistry 2021Quote: ... The coverslips were then incubated for ~ 10 min with 4 μg/ml of Penta•His biotin conjugate antibody (34440, Qiagen, UK) in reaction buffer [40 mM HEPES buffer (pH 7.3 ...
-
bioRxiv - Molecular Biology 2022Quote: Nunc MaxiSorp™ 96-well plates were coated with 75 ng/well of penta-His antibody in PBS solution (Qiagen, 34660) and incubated overnight at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: Lysates of His-tagged α-catenin WT and Δmod were bound to Ni-NTA (Ni2+-nitrilotriacetic acid)-sepharose affinity chromatography (Qiagen), washed with 50 mM Tris pH 7.8 ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from 1,000 H3K27me3 HI/LO β-cells or from 50,000 sorted βHI and βLO cells was extracted using the miRNeasy FFPE Kit (QIAGEN, 217504), followed by the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina® (E6420L) ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell lysates were clarified by additional centrifugation at 14,000 xg for 30 minutes and supernatants were incubated 1 hour at 4 °C with 5 mL of His-Pur™ Ni-NTA resin (Qiagen) previously washed 3 times with 25 mL of Lysis Buffer ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Molecular Biology 2024Quote: ... HIS-fused p300 was expressed from pFastBac1 vector in High-Five cells and purified on Ni-NTA agarose beads (Qiagen, 30210) in BC buffer (20 mM HEPES pH7.9 ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-Strep (Qiagen, 34850, 1:1000 dilution) antibodies ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay12 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Cancer Biology 2020Quote: ... and single erythroid haematopoietic colonies (burst forming unit-erythroid, BFU-E) were plucked and lysed in 50ul of RLT lysis buffer (Qiagen). Library preparation for whole genome sequencing used enzymatic fragmentation and the NEBNext Ultra II low input kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µl RNA was used in a one-step real-time RT-PCR E assay33 using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Microbiology 2022Quote: ... Samples initially underwent a mechanical lysis step by adding samples to a Lysing Matrix E tube and placed within a Tissuelyzer II (QIAGEN), which were lysed for 1 minute at 30 Hz ...
-
bioRxiv - Immunology 2021Quote: ... 5 μl RNA was used in a one-step real-time RT–PCR E assay using the Rotor-Gene probe kit (Qiagen) according to instructions of the manufacturer ...
-
bioRxiv - Developmental Biology 2020Quote: ... mUHRF1 C-terminally tagged with GFP- and 6xHis-tag was expressed in HEK 293T cells and then purified using Qiagen Ni-NTA beads (Qiagen #30230). Recombinant mDPPA3 WT and 1-60 were purified as described above ...
-
bioRxiv - Immunology 2023Quote: For protein production a pT350 plasmid encoding for the construct of interest with a BiP signal sequence in the N-terminal and a double strep-tag in the C-terminal region was co-transfected with a puromycin resistant plasmid (pCoPuro) (61) with effectene reagent (Qiagen, 301425) following manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... His-tagged PSK1 or RGF1 precursors were purified from bacterial extracts by metal chelate affinity chromatography on NiNTA Agarose (Qiagen, Hilden, Germany) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: The recombinant His-TvFACPα full-length protein was produced and purified by a standard protocol as suggested by the supplier (QIAGEN, Hilden, Germany) (48 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and unfragmented genomic DNA (A260/A280 ≥ 1.8 and A260/A230 ≥ 1.9) was extracted from whole blood obtained from the subject and his parents using the Puregene Blood kit from Qiagen (Valencia, CA). Whole exome sequencing was performed using the service provided by Beijing Genomics Institute (Cambridge ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21 Star (DE3) strain and purified by Ni-NTA affinity chromatography with a Ni-NTA agarose column (QIAGEN), followed by size exclusion chromatography with a HiLoad 26/600 Superdex 75 pg column (GE Healthcare ...
-
bioRxiv - Biophysics 2023Quote: ... coli culture were harvested next morning to extract the mutagenesis plasmid library using the QIAfilter Plasmid Midi Kit (QIAGEN). To obtain the final libraries into the yeast plasmids ...
-
bioRxiv - Microbiology 2019Quote: We extracted the DNA from mosquito E/F in the 1.5 ml collection tubes using the QIAamp DNA Micro Kit (QIAGEN, Germantown, Maryland) following a modified version of the manufacturer’s protocol as described elsewhere [38] ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis of 100 ng total RNA was performed with miRCURY LNA RT Kit (10 µl volume reaction) which adds a 5’ universal tag of a poly(A) tail to mature miRNA templates (QIAGEN, Germantown, MD). cDNA template was diluted 1:10 ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were lysed by 1000 μl of Trizol (Qiagen) and mixed with 200 μl chloroform ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... Samples were incubated at 95°C for 5 minutes and spun down at 17K x g for 10 min to remove cell debris before analysis of raw supernatant was performed via SDS-PAGE using a 12% acrylamide-tris gel and subsequent overnight transfer to a Western blot PVDF membrane and visualization with an anti-His antibody (Qiagen Cat# 34440, RRID:AB_2714179).
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...
-
bioRxiv - Genomics 2021Quote: ... coli K12 MG1655 genomic DNA was extracted from a cell culture using the DNEasy Blood and Tissue kit (69504, Qiagen). All the other gDNA from the bacteria presented in Table 1 were isolated using the Monarch genomic DNA purification kit (T3010S ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain (Rosetta) and purified using Ni-NTA affinity chromatography according to the manufacturer’s instructions (Qiagen Cat No./ID: 30210). Purified protein was used as an immunogen to raise polyclonal antibody in rabbits at a local commercial facility (DPL ...
-
bioRxiv - Microbiology 2020Quote: ... coli isolates with QIAmp DNA mini kit or using an EZ1 Biorobot with the DNA Tissue kit (Qiagen, Hilden, Germany). The Nextera XT Kit (Illumina ...
-
bioRxiv - Plant Biology 2021Quote: ... All the plasmids were transformed in to Escherichia coli DH10B electro-competent cells selected with appropriate antibiotics and purified using a Qiaprep Spin Miniprep Kit (Qiagen). Positive clones were transformed in Agrobacterium tumefaciens strain GV3101 and used in infiltrations for transient expression experiments.
-
bioRxiv - Microbiology 2021Quote: ... The new plasmid construct (pSLP15) was transformed into Escherichia coli DH5α chemically competent cells and prepped using the QIAprep spin miniprep kit (Qiagen). Plasmid concentrations were determined using the Qubit dsDNA broad range assay kit with a Qubit 3 fluorometer (Invitrogen) ...
-
bioRxiv - Microbiology 2021Quote: ... coli HST04 dam-/dcm- strains in which target MTases were transformed were extracted using the DNeasy UltraClean Microbial Kit (QIAGEN) according to the supplier’s protocol after induction of gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... coli cells were then grown to isolate the pooled plasmid library by using a Plasmid Midi kit (Qiagen, Germantown, MD) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: During this time a stock of genomic DNA (gDNA) from Escherichia coli (REL606) from ∼72 mL of overnight culture was made using the “DNeasy Ultraclean Microbial kit” (Qiagen), resulting in a stock of ∼30 mL of gDNA at 20 μg/mL (stored at -20 °C) ...
-
bioRxiv - Biophysics 2023Quote: ... coli strain M15-[pREP4] (for transformation of recombinant plasmids) and RNAse (for protein purification) were purchased from Qiagen (Valencia, CA). All other chemicals were obtained from Sigma-Aldrich (St ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids pGS001 and pOXC101(33) were extracted from Escherichia coli DH5α and β3914 respectively using the QIAprep Spin Miniprep Kit (Qiagen). A tac promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli XL1-blue strain was transformed and plasmids were isolated from bacterial cultures using the Plasmid Midi Kit (Qiagen, Germany). Sequencing of the three NS1 plasmids was performed by Eurofins (Germany).
-
bioRxiv - Immunology 2022Quote: ... and 1000 cells were directly deposited in TCL buffer (Qiagen), frozen in dry ice and sent to IMMGEN for RNA sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Crtc2 and GFP expression plasmids were purified from DH5a Escherichia coli cultures using an EndoFree plasmid kit (Qiagen, Valencia, CA, USA), and resuspended in 71 mM sterile PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... coli strain BL21(DE3)(Novogen Inc.) essentially as described [34] except that after elution from Ni-NTA agarose resins (Qiagen Inc.) by incubating with 400 mM imidazole for 1 hr at 4 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... we cultured 250 ml Escherichia coli bacteria bearing transformed plasmids and isolated the plasmids using Qiagen Maxi-Prep Endotoxin-free kit (Qiagen; 12362) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... 128° 11’ 17.2” E) and the genomic DNA was extracted from the whole bodies using DNeasy® Blood & Tissue kit (Qiagen, GmbH, Hilden, Germany). Illumina libraries for whole bodies were constructed using the TruSeq Nano Sample Prep kit (Illumina ...