Labshake search
Citations for Qiagen :
51 - 100 of 188 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... burgdorferi B31-e2 expression strains using the DNeasy Blood and Tissue Kit (Qiagen). The open reading frame (lacking the putative lipoprotein signal sequence ...
-
bioRxiv - Microbiology 2021Quote: ... jejuni strains used for spiking were extracted using QIAamp DNA Mini kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: DNA was isolated from other strains using a MagAttract HMW DNA Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... coli strain TJ249 culture using the QIAGEN DNeasy Blood & Tissue kit (QIAGEN GmbH). The extracted genomic DNA was sequenced on the PacBio RS II platform using P6C4 chemistry at Macrogen (Tokyo ...
-
bioRxiv - Biophysics 2023Quote: ... L6M strain genomic DNA was extracted using the DNeasy Blood & Tissue kit (Qiagen), the library prepared using the KAPA HyperPlus kit (Roche ...
-
bioRxiv - Genomics 2022Quote: ... 25 fmol of the exogenous synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples at the beginning of the extraction procedure to check both the extraction of miRNAs and the efficiency of the cDNA synthesis ...
-
bioRxiv - Cancer Biology 2022Quote: ... after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Those included UniSpike 2 and 4 from the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN, Hilden, Germany), which were used to monitor RNA isolation efficacy ...
-
bioRxiv - Synthetic Biology 2019Quote: ... coli DH10B strains using a QIAprep plasmid miniprep kit (Qiagen, Redwood City, CA, USA) and digested with PvuII (FastDigest ...
-
bioRxiv - Bioengineering 2020Quote: ... and a culture of strain S5 (bPNL037) was grown and then mini-prepped (Qiagen) isolating the pBHV-CymR-vioABE-cmR (P4 ...
-
bioRxiv - Plant Biology 2021Quote: ... DNA was isolated from strains using the QiAmp Micro DNA kit (Qiagen, Hilden, Germany), treated with RNase ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA of the strains was isolated using the Gentra Puregene Yeast Kit (Qiagen). Libraries were made using the Nextera XT DNA Library Prep Kit (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... putida type strain cells (200 μl) was extracted using MagAttract HMW DNA Kit (Qiagen). The DNA was eluted in 100 uL AE buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... each assembled construct was isolated from the cloning strain (QIAprep Spin Miniprep Kit, QIAGEN) and transformed into E ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: The plasmids pIB-spike-V5 with or without pIB-GALNTs-FLAG were transfected to S2R+ cells (DGRC) using Effectene transfection reagent (Qiagen) according to the instructions ...
-
bioRxiv - Genomics 2020Quote: ... We used 0.5 ng of total RNA per tissue sample supplied with Cel-mir-39 spike-in (Qiagen, cat# 339390) to perform the reactions in a final volume of 20uL.
-
bioRxiv - Physiology 2022Quote: ... Total RNA was isolated from 200 μL mouse serum following a standardized protocol (PMID: 24357537) using the miRNeasy Serum Plasma kit with ce-miR-39 spike-in (QIAGEN), QIAcube (QIAGEN ...
-
bioRxiv - Molecular Biology 2019Quote: ... urticae DNA was extracted from the WT strain using the Gentra Puregene Tissue Kit (QIAgen), according to the manufacturer’s instructions and using 100 adult females as starting material ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ...
-
bioRxiv - Microbiology 2020Quote: ... coli C600 strain using an Endofree Maxi-Prep kit from Qiagen (QIAGEN, catalog number 12362) following the manufacturer’s recommendations.
-
bioRxiv - Genomics 2021Quote: ... castellanii strains Neff and C3 using the QIAGEN Blood and Cell Culture DNA Kit (Qiagen) following the specific recommendations detailed by Oxford Nanopore Technologies in the info sheet entitled “High molecular weight gDNA extraction from cell lines (2018)” in order to minimize DNA fragmentation by mechanical constraints ...
-
The formation of a fuzzy complex in the negative arm regulates the robustness of the circadian clockbioRxiv - Molecular Biology 2022Quote: ... crassa strain 87-3 (bd+, mat a) using the Gentra Puregene Tissue kit (Qiagen, 158622) and following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Genomics 2023Quote: ... succinogenes strain UWB7 monoculture & co-culture pellets using the RNeasy Mini Kit (Qiagen, Germantown, MD) following the protocol for purification of total RNA from plant cells and tissues and filamentous fungi ...
-
bioRxiv - Microbiology 2023Quote: ... cholerae ΔSI strain (A101) was extracted using the DNeasy® Blood and Tissue Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: Genomic DNAs were purified from strains CZ26710 and CZ26711 using Gentra Puregene Tissue Kit (Qiagen). Whole genome DNA library preparation and 90 bp paired-end sequencing was performed by Beijing Genomics Institute (BGI ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... we used low-binding plastics and added 1 µl of 0.1 ng/µL tRNA carrier (i.e. spike water, Qiagen, Cat. No. 1068337) in each tube with stock eluted DNA ...
-
bioRxiv - Genomics 2022Quote: ... The sample was incubated at room temperature for 5 min and 3.75μL (25 fmol final concentration) of the synthetic spike-in control Caenorhabditis elegans miRNA cel-miR-39 (Qiagen, Cat. No. 219610) was spiked into samples ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was isolated from strains using the QIAamp DNA mini kit from Qiagen (Hilden, Germany) according to their manufactures protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Richard Vierstra24,54, and phytochrome 1 from Agrobacterium fabrum strain C58 (AgP1, gene Atu1990) in pQE12 (Qiagen) was a kind gift from Prof ...
-
bioRxiv - Microbiology 2019Quote: ... ulcerans CU001 strain calibrated at 1 McFarland = 106 CFU was extracted with EZ (Qiagen, Hilden, Germany). Then ...
-
bioRxiv - Genetics 2022Quote: ... elegans N2 strain genomic DNA with Phusion HF polymerase (New England Biosciences) and gel purified (Qiagen). Enhancer fragments ...
-
bioRxiv - Microbiology 2021Quote: ... genomic DNA of pure cultures of each bacterial strain was extracted using DNeasy PowerSoil Kit (Qiagen) and target genes were amplified by conventional PCR (50 µL reactions ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA was purified from mid-log phase culture of strain ATCC43504 using QIAGEN DNeasy (QIAGEN). A genomic DNA library for sequencing was prepared using the Nextera XT DNA Sample Preparation kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... burgdorferi strain and DNA was extracted using a DNeasy Blood and Tissue kit (Qiagen, Germantown, MD). DNA from ear tissue was subjected to qPCR analysis to verify infection in each host (30) ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA of rescued virus strains was extracted with QIAmp DSP viral RNA mini kit (Qiagen), reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... CDNA fragments were amplified with strain-specific primers using the one step RT-PCR kit (Qiagen). Sequencing was performed by Macrogen Europe ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was amplified with strain-specific primers using a Rotor-Gene Q machine (Qiagen, NSW, Australia) (Table 1) ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) was extracted from the following strains using the DNeasy Blood & Tissue kit (Qiagen): B ...
-
bioRxiv - Immunology 2021Quote: Alignment and phylogenetic tree of the strains within the sarbecovirus subgenus was generated using MEGA 7.0.26 and CLC Main workbench 21.0.3 (Qiagen). The following sequences were retrieved from GISAID and NCBI ...
-
bioRxiv - Microbiology 2023Quote: ... RNA from each strain was extracted using a commercial kit (miRNeasy Mini Kit, Qiagen, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmid DNA was purified from E.coli host strains using the QIAprep Spin Miniprep kit (Qiagen 27106). Plasmid DNA was quantitated using a NanoDrop spectrophotometer and diluted to 20 fmol/μL in nuclease-free water (VWR 02-0201-0500) ...
-
bioRxiv - Microbiology 2023Quote: High-quality DNA from the antagonistic gut strains was extracted using QIAamp DNA minikit (Qiagen, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The total DNA of each strain was extracted using the DNeasy Blood and Tissue kit (Qiagen), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2024Quote: The genomic DNA of strains 16003 and 12E115 was purified using Genomic-tip 100/G (Qiagen). Libraries for Illumina sequencing (average insert size ...
-
bioRxiv - Immunology 2022Quote: ... of soluble SARS-CoV-2 WA1 and SARS-CoV-2 Omicron BA.1 spike trimers were isolated from cell supernatants using a Ni-NTA column (Qiagen, Hilden, Germany). Eluents from Ni-NTA purifications were subjected to SEC using a HiLoad Superdex 200 16/600 column followed by a Superose 6 10/300 (Cytiva ...
-
bioRxiv - Microbiology 2023Quote: The amino acid sequences of coronavirus spike orthologues were subjected to multiple alignment using CLC Workbench 7 (CLC Bio, Qiagen, Aarhus, Denmark). Protein sequence NCBI reference sequences for the indicated viruses are as follows ...
-
bioRxiv - Microbiology 2021Quote: ... difficile strain 630 genomic DNA and cloned into BamHI and PstI sites of pQE30 expression vector (Qiagen). All pQE30-derived plasmids were initially transformed into E ...