Labshake search
Citations for Qiagen :
1 - 50 of 188 citations for Rubella Spike Glycoprotein E1 strain F Therien since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids encoding the recombinant full-length Spike protein and the RBD were provided by F. Krammer (Mt. Sinai) and purified by nickel-nitrilotriacetic acid resin (Qiagen). ELISA plates (Immulon 4 HBX ...
-
bioRxiv - Neuroscience 2023Quote: ... synthetic RNA spike-ins (UniSp2, UniSp4, UniSp5 RNA Spike-in mix; Qiagen) were added and used as quality controls for RNA isolation ...
-
bioRxiv - Neuroscience 2021Quote: ... A set of 52 RNA spike-ins (QIAseq miRNA Library QC Spike-Ins – Qiagen) that spanned a wide range of concentrations were added to the recovered RNAs according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... A set of 52 RNA spike-ins (QIAseq miRNA Library QC Spike-Ins – Qiagen) spanning a wide range of molar concentrations were added to the recovered RNAs ...
-
bioRxiv - Systems Biology 2023Quote: ... 1ul ExiSEQ NGS Spike-in (Qiagen) was added to the extracted RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... coli bacteria (XL1Blue strain or DH5α strain) using plasmid extraction kits (QIAGEN; Venlo ...
-
bioRxiv - Immunology 2023Quote: ... coli strain M15 (Qiagen), and recombinant proteins were produced from the E ...
-
bioRxiv - Neuroscience 2023Quote: ... we added 1 µl of the spike-in mix provided in the QIAGEN RNA Spike-In Kit (Cat. No.: 339390, QIAGEN) to the tube ...
-
bioRxiv - Molecular Biology 2022Quote: ... Spike-in cel-miR-39-3p (MS00019789, Qiagen) was used as an internal control.
-
bioRxiv - Microbiology 2021Quote: ... coli strain M15 [pREP4] (Qiagen) containing a pQE-30 derivative encoding His6-PA1048 ...
-
bioRxiv - Biochemistry 2021Quote: ... coli strain M15 [pREP4] (Qiagen) containing pAJD2948 was grown in 500 mL of LB broth at 37°C to an OD600 of 0.6-1.0 ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain M15 [pREP4] (Qiagen) containing plasmid pAJD3179 encoding His6-PA3978 was grown in LB broth to mid-log phase at 37°C with aeration ...
-
bioRxiv - Microbiology 2023Quote: ... coli strain M15 [pREP4] (Qiagen) containing a plasmid pQE-30 protein-encoding derivative was grown in LB broth to mid-log phase at 37°C with aeration ...
-
bioRxiv - Cell Biology 2022Quote: ... Syn-cel-miR-39 spike in synthetic RNA (Qiagen) was added to monitor extraction efficiency ...
-
bioRxiv - Physiology 2022Quote: ... and 0.15 fmol of the spike-in UniSp6 (Qiagen) were added to the cDNA to control for the reproducibility of the cDNA synthesis.
-
bioRxiv - Molecular Biology 2019Quote: ... Synthetic oligonucleotides obtained from the miRCURY Spike-In kit (Qiagen) were added to the Qiazol lysis buffer before homogenization of the cCM/sEV samples ...
-
bioRxiv - Microbiology 2020Quote: ... and a plasmid expressing VSV-G or HIVKB9 envelope glycoproteins were cotransfected at the mass ratio of 9:1 (9 Hi.fate / 1 Env) using Effectene (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the spike-in control cel-miR-39-3p (QIAGEN, Hilden, Germany) and reverse transcribed (qScript microRNA cDNA synthesis kit Quanta Biosciences ...
-
bioRxiv - Microbiology 2020Quote: Total RNA was extracted from the E1-spiked estuarine sediment sample using the RNeasy® PowerSoil® total RNA kit (Qiagen, Hilden, Germany). The crude total RNA was further purified using Turbo DNA-free Kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... We extracted whole genome DNA of YPS128 strain and RM11-1a strain using the QIAamp DNA Mini Preparation Kit (Qiagen), prepared Nextera DNA library (Illumina ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from an overnight culture of the mutant bacterial strain along with the WT strain using DNeasy PowerSoil Pro kit (QIAGEN), according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: The genomic DNA was extracted from the final resistant strains and the corresponding antibiotic-free strains utilizing the DNeasy Blood and Tissue Kit (Qiagen). Libraries were constructed using the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England BioLabs ...
-
bioRxiv - Microbiology 2023Quote: Total RNA was isolated and purified from the final stable resistant strains and their corresponding antibiotic-free strains using the RNeasy Protect Bacteria Kit (Qiagen). For RNA-Seq analysis ...
-
bioRxiv - Microbiology 2022Quote: ... coli strains containing expression plasmid pQE-9 (Qiagen), pQE9-ftsA ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with the addition of QIAseq miRNA Library QC Spike-ins for normalization (Qiagen). Adenylation of 3’ linker was performed in a 40 μL reaction at 65°C for 1 hr containing 200 pmol 3’ linker ...
-
bioRxiv - Plant Biology 2021Quote: ... atg8h (F-TGCAGTTAGATCCATCCAAAGCTC, R-TCCATGCGACTAGCGGTTTGAG) and atg7 (F-ACGTGGTTGCACCTCAGGATTC, R- ACTAAGAGTTCAACGGCGAGAGC) were quantified using QuantiNova SYBR green PCR kit (Qiagen, 208056) with LightCycler380 in Wt ...
-
bioRxiv - Microbiology 2023Quote: Genomic DNA was extracted from 3 mL overnight cultures of each strain (see Strains Cultivation) using the DNeasy PowerSoil Pro Kit from Qiagen (Hilden, Germany) per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... aeruginosa strains using the QIAamp DNA Mini Kit (Qiagen) according to manufacturers’ instructions ...
-
bioRxiv - Systems Biology 2022Quote: Total RNA was isolated from whole brain tissue from 3 biological replicates per strain for 45 strains of the HRDP using QIAzol (Qiagen, Valencia, CA, USA). The brain was split sagitally and half of the brain was used for RNA sequencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... adding UniSp6 and cel-miR-39-3p RNA Spike-Ins (Qiagen Cat. No 339390). qPCR was done using Qiagen miRCURY SYBR Green Kit (Qiagen Cat ...
-
bioRxiv - Cell Biology 2020Quote: ... dNTPs and synthetic mRNA Spike-Ins contained in 5 μl of Vapor-Lock (Qiagen). Immediately following sorting ...
-
bioRxiv - Neuroscience 2021Quote: ... 3.5ul of miRNeasy Serum/Plasma Spike-In Control (miR-39, 1.6 × 108 copies; Qiagen) was added to each CSF sample ...
-
bioRxiv - Genomics 2021Quote: ... Resulting libraries of synthetic RNA spikes were cleaned up using RNeasy spin columns (Qiagen). Synthetic RNA integrity was confirmed by RNA Nano 6000 chip on the Agilent Bioanalyzer.
-
bioRxiv - Microbiology 2023Quote: ... coli HST08 strain using the QIAprep Spin Miniprep Kit (Qiagen). Recombinant and empty pVRL1Z plasmids were transformed into electro-competent A ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.5 µL of a mixture of spike ins UniSp6 and cel-miR-39-3p (Qiagen) was added to the cDNA reaction ...
-
bioRxiv - Microbiology 2020Quote: ... coli strains was purified using the QIAprep Spin Miniprep Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... total RNA from the respective strains were isolated (Qiagen, Hilden, Germany). After DNase I treatment ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated from the strains using the DNeasy kit (Qiagen), re-transformed into E ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Individual integrase plasmids in each strain were collected by miniprep (Qiagen). The RBS region of each was sequenced by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... which were propagated in strain sSL0281 — purified using Miniprep Kit (Qiagen), and verified by Sanger sequencing (GENEWIZ).
-
bioRxiv - Genetics 2021Quote: ... Hrh1 amplicons from each mouse strain were gel purified (Qiagen Cat# 28115) and DNA sequencing reactions were performed with the BigDye terminator cycle sequencing kit (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... epidermidis 1585 WT strain using the Qiagen DNA kit (Qiagen, Hilden, Germany) by following the instructions of the manufacturer ...
-
bioRxiv - Plant Biology 2021Quote: ... coli strain BL21(BE3) and purified using Ni-NTA agarose chromatography (Qiagen) as previously described (Xu et al. ...
-
bioRxiv - Microbiology 2021Quote: ... abscessus strain ATCC 19977 published genome using CLC Genomic Workbench software (Qiagen). To minimize the skewing effect that certain PCR jackpots had on the data ...
-
bioRxiv - Microbiology 2023Quote: Total RNAs from Leptospira strains were extracted using QIAzol lysis reagent (Qiagen) and purified with RNeasy columns (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: The three cell mock communities (even, staggered, and spike-in) were diluted with Buffer AVE (Qiagen, Hilden, Germany) and split into eight replicates per mock and dilution for subsequent DNA extraction ...
-
bioRxiv - Microbiology 2020Quote: ... coli 10-beta cloning strain were purified using the standard QIAprep protocol (QIAGEN), then delivered to the Pseudomonas strain via previously published electroporation83 or conjugation84 protocols ...
-
bioRxiv - Microbiology 2021Quote: DNA from strain ISS312 was extracted using the DNeasy Blood & Tissue kit (Qiagen), following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... the total RNA of Smu57 strain was isolated using RNeasy Mini Kit (QIAGEN) according to manufacturer’s protocol ...