Labshake search
Citations for Qiagen :
51 - 100 of 1849 citations for Recombinant Human Neuropilin 1 Fc Chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Nickel sepharose according to the manufacturer’s instructions (QIAGEN). The purified recombinant protein was dialyzed overnight against dialysis buffer (20 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... The recombinant TDP-43 proteins were purified over Ni-NTA agarose beads (Qiagen) and eluted using 50 mM HEPES (pH 7.5) ...
-
bioRxiv - Molecular Biology 2021Quote: RNA was isolated from INS-1 and human islets 48 hours post transfection using RNeasy cleanup kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Poly-histidine-tagged recombinant proteins were purified using Ni-NTA-Agarose (Qiagen, Hilden, Germany) beads according to manufacturer’s instructions and were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Molecular Biology 2019Quote: ... recombinant protein was enriched via a Ni+2-nitroloacetic acid column (Ni-NTA; Qiagen), as described previously (Edwalds-Gilbert et al ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant protein was purified by incubation with Qiagen Ni-NTA agarose beads (Qiagen) for 1 h followed by three washing steps with the lysis buffer before elution with lysis buffer containing increasing concentrations of imidazole ...
-
bioRxiv - Biochemistry 2022Quote: ... Preparations of recombinant plasmids were conducted using the QIAprep Spin Miniprep Kit from QIAGEN, and then these plasmids were sequenced by BGI Group (Genome Sequencing Company) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant HisCheY or HisCheY* and bound proteins were purified using nickel agarose columns (Qiagen) under native conditions per manufacturers’ instructions.
-
bioRxiv - Bioengineering 2020Quote: ... and recombinant proteins were isolated from the periplasmic fraction using Ni-NTA beads (Qiagen). Following washing and subsequent elution with 50 mM Tris (pH 8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Recombinant MBP-Dnmt5(345-747)-6xHis was purified using Ni-NTA agarose resin (Qiagen) and measured by A280 (ε = 139,790 cm-1 M-1).
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant TDP-43 was purified using the Ni-NTA SpinColumn purification kit (31014, Qiagen), essentially according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence-verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids from transformants were isolated using the QIAprep® Spin Miniprep Kit (Qiagen) and sequence verified via Sanger sequencing (Microsynth ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins produced in the supernatant were purified using Ni-NTA agarose (QIAGEN). To biotinylate RBD proteins ...
-
bioRxiv - Cell Biology 2022Quote: Constructs for recombinant bacterial protein expression were all cloned in the pQE plasmid (Qiagen). Su9-DHFR and CaM-3C-Alfa-Sec61β(2–60)-OMP25(112–145)F128Amber were cloned downstream of a His14-bdSUMO tag ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant proteins were purified according to manufacturer’s instructions by Ni2+-NTA agarose beads (QIAGEN). Washing steps were performed with a buffer containing 20 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 mM imidazole and the recombinant V0c was purified over Ni-NTA beads (QIAGEN).
-
bioRxiv - Microbiology 2023Quote: ... The recombinant plasmid was purified using QIAgen mini prep kit (cat no.27106, Qiagen) as per manufacture’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant plasmids were extracted by using the EndoFree Plasmid Maxi Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Plant Biology 2022Quote: ... and the recombinant protein was purified on Ni-NTA agarose following the manfacturer’s instructions (Qiagen). The eluate (3x 500 μl ...
-
bioRxiv - Immunology 2020Quote: ... The linearized recombinant gDNA was transfected into 293 cells using the PolyFect Transfection Reagent (Qiagen). After virus rescue was observed via plaque formation ...
-
bioRxiv - Microbiology 2019Quote: ... The recombinant Lsr2 proteins were purified using immobilized-metal affinity chromatography (Ni-NTA agarose, Qiagen) and size exclusion chromatography ...
-
Structure and Neutralization Mechanism of a Human Antibody Targeting a Complex Epitope on Zika VirusbioRxiv - Microbiology 2022Quote: ... Recombinant Fab proteins were purified from the culture supernatant by nickel-nitrilotriacetic acid agarose (Qiagen). Recombinant mAbs were affinity purified by MabSelect resin (Cytiva ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All recombinant DNA was isolated and purified through Miniprep kits according to manufacturer’s instructions (Qiagen). Sequences were confirmed by Sanger sequencing.
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Synthetic Biology 2021Quote: 6His-tagged Mdb1 recombinant protein was expressed in BL21 and purified using Ni-NTA beads (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid was extracted from the positive transformant using Qiagen® Plasmid Mini (Qiagen, USA) and sequenced (Advanced Innovative Trusted Products & Solutions ...
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified using the His-tag Protein Purification Kit (Ni-NTA Agarose, QIAGEN GmbH), GST-tag Protein Purification Kit (Glutathione Sepharose ...
-
bioRxiv - Microbiology 2022Quote: The human Hh signaling target PCR array (Qiagen) profiled the expression of 84 key genes responsive to Hh signal transduction ...
-
bioRxiv - Cell Biology 2020Quote: ... Human cell motility RT2 profiler PCR Array (Qiagen) for control-MPC and Givi-MPC was performed ...
-
bioRxiv - Microbiology 2021Quote: Human colon resections were placed in RNAlater (Qiagen) at the time of resection ...
-
bioRxiv - Microbiology 2023Quote: The human Hippo signaling target PCR array (Qiagen) was used to determine expression of 84 key Hippo target genes ...
-
bioRxiv - Microbiology 2023Quote: Human Inflammatory Response & Autoimmunity Focus) (Qiagen, YAHS-205Z) were used for each of the different samples ...
-
bioRxiv - Physiology 2024Quote: ... and Qiagen human Primer Assays (Qiagen, Hilden, Germany) specific for FoxO1 and FoxO3 (the latter only in NHBEs) ...
-
bioRxiv - Cell Biology 2020Quote: ... 20 ng of cDNA was used for qPCR with the Human Cellular Senescence and Human Aging RT2 Profiler™ PCR Arrays (Qiagen). Arrays were run on the 7300 Real Time PCR System (Life Technologies ...
-
bioRxiv - Developmental Biology 2022Quote: ... Total RNA from the control human TSCs as well as WWTR1-KD human TSCs were isolated using RNeasy Mini Kit (Qiagen, 74104) per the manufacturer’s protocol with on column DNase digestion ...
-
bioRxiv - Molecular Biology 2021Quote: Hepatic gene expression was investigated using qPCR arrays designed for human (RT2 Profiler PCR arrays – ‘Human Fatty Liver’, Qiagen France SAS). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... selected by p value and/or fold change (FC) as indicated were uploaded into the IPA software (Qiagen). The Core Analyses function included in the software was used to interpret the data for top canonical pathways.
-
bioRxiv - Immunology 2019Quote: His-tag purified recombinant proteins were expressed in E.coli and purified by Ni+-NTA-agarose column (Qiagen). Then ...
-
bioRxiv - Cancer Biology 2020Quote: ... The recombinant plasmid pENTR-CTDSP1 was extracted from positive colonies using the QIAprep Spin Miniprep Kit (Qiagen) and proper orientation of the cloned fragment was verified by PCR and DNA sequencing ...
-
bioRxiv - Biochemistry 2021Quote: ... The polyhistidine-tagged recombinant proteins were then purified from bacterial lysates with Ni2+-NTA agarose beads (QIAGEN) and washed by three different washing buffers (Washing buffer 1 contained 20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant plasmids were extracted from cell pellets using the QIAprep Spin Miniprep kit (Qiagen, Valencia, CA, USA). The sequence of the inserts was confirmed by Sanger sequencing (W ...
-
bioRxiv - Plant Biology 2023Quote: ... The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN, Cat. No. 30210) according to the product protocol ...