Labshake search
Citations for Qiagen :
1 - 50 of 1849 citations for Recombinant Human Neuropilin 1 Fc Chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: RNA from human microglia differentiated in vitro and human microglia extracted from human-mouse chimeras was extracted using the RNeasy Plus Micro Kit (Qiagen). The RNA from 3 independent in vitro microglia differentiations per cell line were pooled at equal weight to obtain six samples ...
-
bioRxiv - Biochemistry 2023Quote: ... The harvested cells of TonAmyGT and Chimera 4 were re-sususpended with non-denaturing lysis buffer (Qiagen) and 0.2 % of Sarcosyl and kept overnight for re-suspension ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant GST-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 66,030 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant MBP-Dnmt5(1-150)-6xHis was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 89,590 cm-1 M-1) ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant proteins were purified on Ni-NTA columns (1 ml Ni-NTA Agarose; Qiagen Cat # 30210), washed with 20 ml hexokinase buffer (20 mM HEPES ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant plasmids were then isolated (MiniPrep, Qiagen) and sequenced (DNA Sequencing Facility ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339, human METTL3: QIAGEN SI05020414 and human DDX6 ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Microbiology 2023Quote: ... All treatment groups were supplemented with 1 % FCS and RNA was extracted in RNAeasy Plus lysis buffer (QIAGEN) 6 h post treatment.
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757, human YTHDF3: QIAGEN SI04133339 ...
-
bioRxiv - Biochemistry 2022Quote: ... 10% glycerol and 1 mM DTT) and recombinant TrcP was purified from clarified lysates using Ni-NTA resin (Qiagen) and gravity chromatography ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715, human YTHDF2: QIAGEN SI00764757 ...
-
bioRxiv - Plant Biology 2021Quote: ... recombinant protein and purified using Ni-NTA resin (Qiagen). Polyclonal antibodies were raised in mice as described in 1 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Recombinant protein was purified using Ni-NTA agarose (Qiagen). Rabbit polyclonal antibodies were generated by Covance ...
-
bioRxiv - Microbiology 2021Quote: Recombinant protein was blotted with anti-His antibody using the same method: 1:2000 mouse anti-tetra-His IgG (Qiagen); 1:1500 goat anti-mouse IgG-HRP (Dako) ...
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...
-
bioRxiv - Developmental Biology 2020Quote: ... recombinant proteins were purified using Ni-NTA Agarose (Qiagen 30210). Buffer was exchanged by dialysis to PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Recombinant proteins were purified using Ni-NTA affinity resin (Qiagen) according to standard protocols (21) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant proteins were then purified by Ni-NTA-agarose (Qiagen) affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... The recombinant proteins were purified using nickel affinity chromatography (Qiagen). As the final purification step ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins were purified with Ni-NTA chromatography (Ni2+-nitrilotriacetate, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant protein was initially purified by nickel affinity chromatography (Qiagen, Holland) and subsequent size exclusion using Superdex 200 increase (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Immunology 2023Quote: ... Recombinant protein was purified by binding to Ni-NTA beads (Qiagen) and eluted in the same buffer supplemented with 300 mM imidazole ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant protein was purified by Ni-NTA affinity chromatography column (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... Recombinant protein in the supernatant was purified via Ni2+-NTA (Qiagen, UK) column [20].
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were purified from lysates on Ni-NTA columns (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...
-
bioRxiv - Cancer Biology 2023Quote: ... with Quantitect human primers (Qiagen) for genes ID1 ...
-
bioRxiv - Biophysics 2021Quote: ... and Fc-tag ACE2 protein was purified using a protein affinity A column (Qiagen). Proteins were further purified by gel filtration (Superdex™ 200 Increase 10/30GL ...
-
bioRxiv - Plant Biology 2020Quote: ... Recombinant proteins were affinity purified using nickel-nitrilotriacetic acid (Ni-NTA) agarose (Qiagen) and elution with imidazole ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The recombinant proteins were purified under denaturing conditions on Ni-NTA agarose (Qiagen). The purified proteins were used for rat immunization in an in-house animal facility at the Charles University.
-
bioRxiv - Cell Biology 2021Quote: ... The soluble recombinant protein was purified using theNickel-Nitrilotriacetic acid (Ni-NTA+; Qiagen) resin ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... under p32 promoter to the recombinant expression using PCR Cloning Kit (Qiagen, Germany). The recombinant plasmids were named as pMG36e:nisA (nisA) ...