Labshake search
Citations for Qiagen :
101 - 150 of 1963 citations for Recombinant Human Lectin Galactoside Binding Soluble 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... as previously described.10 Detection of 6x His-tagged recombinant POLIB variants was performed with primary antibody Penta•His (1:1000, Qiagen) for one hour ...
-
bioRxiv - Biophysics 2021Quote: ... Supernatant was collected for 2.5 h binding with Ni-nitrilotriacetic acid resins (Qiagen) at 4°C ...
-
bioRxiv - Genomics 2019Quote: ... the supernatant extracted and subjected to batch binding with 5ml of NiNTA (Qiagen) for 2hrs ...
-
bioRxiv - Molecular Biology 2021Quote: ... according to the manufacturers’ instructions and purified through a DNA-binding column (Qiagen). The quality and quantity of cDNA was measured using a Nanodrop spectrophotometer (Nanodrop Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... The resulting supernatant was subject to binding with Ni-NTA agarose resin (Qiagen) for 30 min at 4 °C with gentle rotation and loaded into the glass chromatography columns (Bio-Rad ...
-
bioRxiv - Biochemistry 2023Quote: ... the lysate was centrifuged at 15,000 x g for 35 mins and the soluble fraction incubated with 3 mL of Ni-NTA beads (Qiagen) for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2023Quote: ... Soluble lysate was prepared by centrifugation and the kinase domain of FGFR1 was isolated by Ni-NTA column (Qiagen).
-
bioRxiv - Developmental Biology 2020Quote: ... recombinant proteins were purified using Ni-NTA Agarose (Qiagen 30210). Buffer was exchanged by dialysis to PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... Recombinant proteins were purified using Ni-NTA affinity resin (Qiagen) according to standard protocols (21) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recombinant proteins were then purified by Ni-NTA-agarose (Qiagen) affinity chromatography ...
-
bioRxiv - Biophysics 2023Quote: ... The recombinant proteins were purified using nickel affinity chromatography (Qiagen). As the final purification step ...
-
bioRxiv - Microbiology 2022Quote: ... the His-ChuP protein was purified from the soluble extract by affinity chromatography in a Ni-NTA Superflow column (Qiagen). The elution fractions were evaluated using 18% SDS-PAGE ...
-
bioRxiv - Biochemistry 2020Quote: ... Lysates were cleared by centrifugation at 20,000 rpm for 1 hour at 4°C and the soluble fraction was affinity purified by gravity column with Ni-NTA affinity resin (QIAGEN). The protein was eluted by 50 mM Tris pH 8 ...
-
bioRxiv - Biochemistry 2021Quote: ... The soluble extracts were applied to 2-ml columns of nickel-nitrilotriacetic acid- agarose (Ni-NTA) (QIAGEN catalog no. 30210) that had been equilibrated with lysis buffer without protease inhibitors ...
-
bioRxiv - Biophysics 2023Quote: ... The soluble extracts were applied to 2 ml columns of nickel-nitrilotriacetic acid agarose (Ni-NTA) (QIAGEN catalogue no. 30210) that had been equilibrated with lysis buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... His-EHD1 was purified by binding with Ni2+-NTA His-bind slurry (Qiagen, Germany) and eluting with imidazole as described previously (65) ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.01M Tris-Cl (pH 8.0) and passed through a Ni-NTA binding column (Qiagen). The loaded column was washed with 8M urea ...
-
bioRxiv - Biochemistry 2022Quote: ... The detection of binding was carried out by the RGS His6 HRP conjugate (QIAGEN) that detects the RGS His6 motif present in the affitins N-terminal ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant proteins were purified with Ni-NTA chromatography (Ni2+-nitrilotriacetate, Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Recombinant plasmids were purified with EndoFree Plasmid Maxi Kit (12362, QIAGEN). Oligonucleotide sequences and further details are provided in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2022Quote: ... recombinant protein was initially purified by nickel affinity chromatography (Qiagen, Holland) and subsequent size exclusion using Superdex 200 increase (GE Healthcare ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Uhrf1 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 40,920 cm-1 M-1) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Recombinant 6xHis-Swi6 was purified with Ni-NTA agarose resin (Qiagen), measured by A280 (ε = 45,330 cm-1 M-1) ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant HCMVs were reconstituted from HCMV BAC DNA by Superfect (Qiagen) transfection into permissive MRC-5 cells.
-
bioRxiv - Plant Biology 2023Quote: ... Recombinant proteins were purified with Ni2+-nitrilotriacetic acid agarose beads (Qiagen) and desalted with Bio-Gel P-6DG gel (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Biophysics 2021Quote: ... Next the lysate was clarified by centrifugation and the soluble fraction was incubated with equilibrated Ni-NTA resin (Qiagen cat#4561) for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2019Quote: ... The soluble 6His-tagged proteins were purified from the supernatant by affinity chromatography using Ni2+-NTA agarose resin (Qiagen, Hilden, Germany). After several washing steps ...
-
bioRxiv - Cell Biology 2023Quote: ... The protein was purified from soluble fraction under native conditions using Ni2+– NTA affinity chromatography (Ni2+ beads obtained from Qiagen, #30210), followed by a second step of purification involving gel filtration chromatography using Superdex 200 10/300 GL (GE Healthcare ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Cell Biology 2022Quote: ... The mRNA binding to beads was eluted and purified with RNeasy MinElute Spin columns (Qiagen), followed by cDNA synthesis ...
-
bioRxiv - Cell Biology 2022Quote: ... Binding of Ad2 was detected by an HRP-conjugated monoclonal antibody to His-tag (Qiagen) expressed by the fiber knob ...
-
bioRxiv - Genomics 2023Quote: ... Reactions were stopped by adding the appropriate volume of Binding Buffer (Qiagen MinElute PCR Kit) and the DNA was purified using the Qiagen MinElute PCR Kit according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the recombinant protein was purified by Ni-NTA affinity chromatography column (QIAGEN).
-
bioRxiv - Microbiology 2019Quote: ... Recombinant protein in the supernatant was purified via Ni2+-NTA (Qiagen, UK) column [20].
-
bioRxiv - Biophysics 2021Quote: ... The recombinant proteins were purified from lysates on Ni-NTA columns (Qiagen).
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant proteins were purified over nickel-nitrilotriacetic acid (Ni-NTA) Agarose (Qiagen). Therefore ...
-
bioRxiv - Bioengineering 2023Quote: ... Recombinant plasmids were prepared by using the QIAprep Spin Miniprep Kit (QIAGEN) and confirmed by sequencing analysis ...
-
bioRxiv - Microbiology 2019Quote: ... and the 6xHis-SUMO tagged proteins were purified from the soluble protein fraction after centrifugation using an Ni2+-NTA Superflow column (Qiagen, Venlo, Netherlands). Next ...
-
bioRxiv - Microbiology 2019Quote: ... soluble and insoluble fractions were separated by centrifugation and analyzed by SDS-PAGE and western blot using anti-Strep (Qiagen, Hilden, Germany) and anti-His (GE Healthcare ...
-
bioRxiv - Bioengineering 2020Quote: ... the resulting supernatant containing soluble LCC was subjected to purification by immobilized metal ion chromatography (IMAC) using Ni-NTA Superflow (Qiagen, Hilden, Germany). Protein elution using 250 mM imidazole was then dialyzed against 100 mM potassium phosphate buffer (pH 8 ...
-
bioRxiv - Biochemistry 2021Quote: ... The labeled protein in the soluble fraction was purified using Immobilized Metal Affinity Chromatography (IMAC) using standard methods (QIagen Ni-NTA resin). The purified protein was then concentrated to 2 mL and purified by FPLC sizeexclusion chromatography using a Superdex 75 10/300 GL (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tag fusions were purified by incubating the bacterial soluble fraction with pre-equilibrated Ni-NTA agarose bead slurry (Qiagen, Hilden, Germany) for 1 hour at 4°C and eluting with 500 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: Human DUOX1: GPH1004464(-)02A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: Human DUOX2: GPH1018346(-)08A (Qiagen)
-
bioRxiv - Cell Biology 2020Quote: ... Human RPLP0 (primers from QIAGEN) was used as reference gene for cDNA from Caco-2 samples ...
-
bioRxiv - Cell Biology 2022Quote: ... for siRNAs (human YTHDF1: QIAGEN SI00764715 ...