Labshake search
Citations for Qiagen :
51 - 100 of 10000+ citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... RT-PCR on the recovered mRNA was performed using the SensiScript RT Kit (Qiagen) with reverse primers that bound the 3’ end of each POI sequence ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of subgenomic RNA was performed by real-time reverse transcription PCR (RT-PCR) using a QuantiTect Probe RT-PCR Kit (QIAGEN, Hilden, Germany) with primers and probes as previously described [39] ...
-
bioRxiv - Genetics 2020Quote: ... 20 µl RT-PCRs were performed as per the manufacturer’s instructions using the Qiagen One-Step RT-PCR kit (210210, Qiagen) and the following primers ...
-
bioRxiv - Cell Biology 2019Quote: ... We then used the purified RNA samples for RT-PCR with the OneStep RT-PCR kit (cat# 210210, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... Expression of the genes of interest was also confirmed using RT-PCR using the OneStep RT-PCR Kit (Qiagen) before the experiment was conducted ...
-
bioRxiv - Microbiology 2021Quote: ... and subjected to real-time RT-PCR for viral RNA quantitation [40] using QuantiTect Probe RT-PCR Kit (Qiagen) and QuantStudio 5 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-PCR was performed with 200 ng of extracted total RNA using a Qiagen OneStep RT-PCR Kit (Qiagen). The primers used were a forward primer (Hokkaido System Science ...
-
bioRxiv - Cell Biology 2019Quote: RT-PCR or PCR products were cleaned up with QIAquick PCR purification kit (28106, QIAGEN) or QIAquick Gel Extraction kit (28706 ...
-
bioRxiv - Microbiology 2020Quote: PCR products obtained by above RT-PCR were purified by QIAquick PCR Purification Kit (QIAGEN) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2020Quote: ... Quantitative PCR was performed using the QuantiTech SYBR Green RT-PCR kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-PCR was conducted using QuantiTect SYBR Green PCR Kit (Qiagen; Germantown, MD) in 96 well PCR plates (Bio-Rad ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative RT-PCR was performed using the RotorGene SyBr Green PCR kit (Qiagen) in a Rotorgene Q PCR cycler under the following amplification conditions ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Real-time PCR was performed with QuantiTect SYBR green RT-PCR kit (Qiagen) in an ABI 7500 Fast system ...
-
bioRxiv - Molecular Biology 2022Quote: ... RT-qPCR reaction was carried out using the QuantiNova Kit Probe RT-PCR Kit (Qiagen, catalog #208354, Germany), using primers and probe described in Naveca et al ...
-
bioRxiv - Microbiology 2023Quote: ... Primers and probe targeting the AIV matrix gene 36 were used to perform the quantitative RT-PCR (qRT-PCR) reaction by using the One-Step RT-PCR Kit (QIAGEN, Valencia, CA, USA) on a StepOne Real-time PCR System (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: RT-qPCR was carried out using QuantiTect SYBR® Green RT-PCR Kit (Qiagen, 204243) using the primer pairs detailed in Supplementary Table S11 ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... evidence for successful ACE2 transduction was determined by real-time RT-PCR for mCherry mRNA with the OneStep RT-PCR kit (Qiagen). All samples for mCherry analysis were evaluated in one RT-PCR run ...
-
bioRxiv - Microbiology 2022Quote: ... primer sets were designed based on the Medaka-polished contigs and used for the RT-PCR amplification of regions of interest using the OneStep RT-PCR kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: The cells previously frozen in plates were thawed on ice and RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) protocol without modification ...
-
bioRxiv - Systems Biology 2019Quote: ... Clones were screened for translocations and the cDNA breakpoint determined by RT-PCR in a 96-well AB Veriti Fast Thermal Cycler using the Quantitect SYBR green RT-PCR kit (Qiagen) according to the manufacturers instructions with an annealing temperature of 56°C for 30 seconds ...
-
bioRxiv - Pathology 2021Quote: ... and from lung and/or heart tissues of seropositive rodents were used to amplify viral genome by RT- PCR using the One Step RT-PCR kit (QIAGEN) followed by nested or heminested PCRs (Taq Pegasus ...
-
bioRxiv - Immunology 2020Quote: ... The presence of the desired mutations in the viral genomes was verified by sanger sequencing of RT-PCR amplicons generated with the OneStep RT-PCR-kit (Qiagen) using LCMV WE GP-specific primers (GATTGCGCTTTCCTCTAGATC and TCAGCGTCTTTTCCAGATAG) ...
-
bioRxiv - Microbiology 2022Quote: ... villosum) (Table 1) were used in RT-PCR tests conducted in Slovenia using the OneStepTM RT-PCR kit (Qiagen, USA) as previously described (Rivarez et al ...
-
bioRxiv - Molecular Biology 2023Quote: Quantitative RT-PCR was performed using 30 ng of total RNA and QuantiTecT sYBR Green RT-PCR kit (Qiagen, 204243) according to the supplier’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... Transcript-specific primers were designed to span introns and the spcar3 mutation site and used in one-step RT-PCR reactions (210210, OneStep RT-PCR kit, Qiagen). Primer sequences for qRT-PCR are listed in Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... using the One Step RT-PCR kit (Qiagen, Hilden, Germany) for RHDV2 ...
-
bioRxiv - Microbiology 2021Quote: ... The one-step QuantiTect SYBR Green RT-PCR kit (Qiagen) was used to synthesize the cDNA and perform qPCR under the following conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... A QuantiFast SYBR Green RT-PCR kit (Qiagen; Hilden, Germany) was used to perform real time PCR on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Microbiology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Microbiology 2022Quote: ... and cDNA amplification using a OneStep RT-PCR Kit (Qiagen) and segment-specific primers (sequences available upon request) ...
-
bioRxiv - Microbiology 2022Quote: ... using the Qiagen OneStep RT-PCR kit (Qiagen, Hilden, Germany). The conventional RT-PCR was adapted from Bouscambert-Duchamp (Bouscambert-Duchamp et al. ...
-
bioRxiv - Microbiology 2022Quote: ... using the Qiagen OneStep RT-PCR kit (Qiagen, Hilden, Germany), with primers mix Fw 5 ‘-CAATGCAGGTATAACAC.’CAGCAATATC-3’ and Rv 5’-GCAACAATTGAACTGATCTTCAGGAAAC-3’ 50μM each ...
-
bioRxiv - Immunology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ).
-
bioRxiv - Immunology 2021Quote: ... and S was amplified using OneStep RT-PCR Kit (Qiagen). The mutations were identified by Sanger sequencing (GENEWIZ) ...
-
bioRxiv - Immunology 2022Quote: ... and the QuantiFast Probe RT-PCR +ROX Vial Kit (Qiagen), in the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... and the QIAGEN OneStep RT-PCR Kit (Qiagen, Venlo, Netherlands). Amplicon length and concentration was analysed using HS DNA 1000 with TapeStation 2200 (Agilent ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed using miScriptSYBR Green PCR Kit (Qiagen) and commercially available miRNA Primer Assays (Table.S1 ...
-
bioRxiv - Microbiology 2023Quote: ... and quantified using QuantiFast SYBR Green RT-PCR Kit (Qiagen) and a CFX96 Touch Real-Time PCR Detection thermocycler (BioRad) ...
-
bioRxiv - Cell Biology 2023Quote: ... A QuantiFast SYBR Green RT-PCR kit (Qiagen; Hilden, Germany) was used to perform real time PCR on a LightCycler 480 (Roche Diagnostics ...
-
bioRxiv - Immunology 2024Quote: ... TCRα/β were amplified using OneStep RT-PCR kit (Qiagen) according to the manufacturer recommendation ...
-
bioRxiv - Physiology 2023Quote: ... RT-qPCR was performed (QuantiTect SYBR Green PCR Kit, Qiagen) in duplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription and quantitative real-time PCR (qRT-PCR) were performed with miScript II RT Kit and SYBR Green PCR Kit respectively (QIAGEN). To quantify α-Syn mRNA levels ...
-
bioRxiv - Immunology 2023Quote: ... amplification of TCRβ-chain transcripts and library preparation was performed with the arm-PCR (ampliconrescued multiplex PCR) technology (iRepertoire Inc. Huntsville, USA) using the Qiagen OneStep RT-PCR Kit and Qiagen Multiplex PCR Kit (both Qiagen) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2020Quote: ... Q-RT-PCR was conducted using the miScript SYBR Green PCR Kit (218073, Qiagen) as indicated by the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... RT-PCR for specific miRNAs was performed using miRCURY LNA miRNA PCR Kit (Qiagen) following the manufacturer’s protocol (miRCURY LNA miRNA PCR-Exosomes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The first round of PCR was performed using the OneStep RT-PCR Kit (Qiagen) with primer pair AK4340F1 and AK4630R1 (Kapoor et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed using the QuantiTect SYBR Green RT-PCR Kit (Qiagen, Germany). The gene-specific primers capable of amplifying 150-250 bp region from all the three homoeologous of two TaVIH genes were carefully designed using Oligocalc software ...
-
bioRxiv - Cell Biology 2023Quote: ... For real-time quantitative PCR (RT-qPCR) QuantiTect SYBR Green PCR Kit (Qiagen, 204145) and the LightCycler 480 system II from Roche were used ...
-
Global genetic patterns reveal host tropism versus cross-taxon transmission of bat BetacoronavirusesbioRxiv - Evolutionary Biology 2020Quote: ... All RNA extracts were subjected to reverse transcription polymerase chain reaction (RT-PCR) using the one-step RT-PCR kit (Qiagen, USA) and PanCoV F2 (5’-AAR TTY TAY GGH GGY TGG-3’ ...