Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for RT PCR kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... RT-PCR was performed using OneStep RT-PCR Kit (QIAGEN) using the following primers ...
-
bioRxiv - Plant Biology 2020Quote: ... RT-PCR was performed using the OneStep RT-PCR kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... RT-PCR was performed using One Step RT-PCR kits (Qiagen) and a mixture of TRAV- ...
-
bioRxiv - Plant Biology 2024Quote: ... RT-PCR was conducted using a OneStep RT-PCR kit (Qiagen) with the following primer pair ...
-
bioRxiv - Cell Biology 2019Quote: ... OneStep RT-PCR Kit (Qiagen) was used for reverse transcription of HA fragment with specific primers (Forward ...
-
bioRxiv - Microbiology 2021Quote: ... Quantitative RT-PCR was performed using QuantiTect Probe RT-PCR Kit (Qiagen) in a StepOnePlus™ Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2019Quote: ... RT-PCR reactions were prepared using QuantiTect Probe RT-PCR Kit (Qiagen), with final concentrations of primers and probe used were 400 nM and 200 nM respectively ...
-
bioRxiv - Microbiology 2020Quote: ... rt-PCR was conducted with a OneStep RT-PCR kit (Qiagen Canada) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2019Quote: RT-PCRs were performed with the One-step RT-PCR kit (QIAGEN) with SAO00187/SAO00188 (for 12S rRNA) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using the OneStep RT-PCR Kit (Qiagen, #210212), with the following conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... RT-PCR was performed by QuantiTect SYBR Green RT-PCR kit (Qiagen) using the following primer ...
-
bioRxiv - Microbiology 2022Quote: Nested RT-PCRs were performed using the OneStep RT-PCR kit (Qiagen). In each reaction ...
-
bioRxiv - Microbiology 2021Quote: ... The RT-PCR was performed using Qiagen One-Step RT-PCR kit (Qiagen) master mix ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed using a One-Step RT-PCR kit (Qiagen, #210210) using the following primers Forward ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Quantitative RT-PCR was performed using Quanti Tect Probe RT-PCR Kit (Qiagen) in a StepOne Plus™ Real-Time PCR System (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... and RT-PCR carried out using the One-Step RT-PCR kit (Qiagen) according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2020Quote: ... and LC480 I (Roche)-QuantiNova Probe RT-PCR Kit (Qiagen); ii ...
-
bioRxiv - Genomics 2020Quote: ... End-point RT-PCR was performed using the one-step RT-PCR kit (QIAGEN) following manufacturer’s instructions ...
-
TrkB induced metastatic potential of cancer by suppression of BMP mediated tumor inhibitory activitybioRxiv - Cancer Biology 2020Quote: ... and RT-PCR analysis was performed using a One-Step RT-PCR kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2020Quote: ... Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen) and a LightCycler 480 thermocycler (Roche Diagnostics ...
-
Target of Rapamycin Complex 2 modulates development through Hedgehog/Patched signaling in C. elegansbioRxiv - Developmental Biology 2022Quote: ... Quantitative RT-PCR was performed with the QuantiTect SYBR Green RT-PCR kit (Qiagen) in a Bio-Rad CFX96 RT-PCR thermocycler ...
-
bioRxiv - Microbiology 2023Quote: ... RT-PCR was performed using the OneStep RT-PCR kit (Qiagen, Cat. No. 210212) with the following conditions ...
-
bioRxiv - Microbiology 2023Quote: ... RT-PCR was performed with the Qiagen® OneStep RT-PCR kit (Qiagen, USA). PCR in the second step was performed as described above.
-
bioRxiv - Plant Biology 2023Quote: ... for RT-PCR and semiquantitative RT-PCR and an RNeasy Plant Mini Kit (Qiagen) for RT-qPCR RNA gel blots ...
-
bioRxiv - Microbiology 2020Quote: ... Seven overlapping RT-PCR fragments were generated with the One-Step RT-PCR Kit (Qiagen) and purified using the Zymoclean Large Fragment DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Genomics 2023Quote: ... Gel-based RT-PCR analyses were performed using the One-Step RT-PCR kit (Qiagen) in a final volume of 10 µL starting from 0.03 µg of DNase- treated (RQ1 Rnase-free Dnase supplemented with Rnasin Ribonuclease Inhibitor ...
-
bioRxiv - Microbiology 2022Quote: ... The QuantiNova Probe RT-PCR kit (Qiagen) was used with a LightCycler 480 Real-Time PCR System (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... Mx3000/5P thermocylers series (Agilent)-QuantiFast Probe RT-PCR+ROXvial Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... or QuantiTect Probe RT-PCR Kit (Qiagen) in a 12.5 μl reaction including 2.5 μl extracted DNA or RNA ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (100 ng) was analyzed by reverse transcription-PCR (RT-PCR) using the OneStep RT-PCR kit (Qiagen). RNA was reverse transcribed and amplified in a total volume of 50 μl containing 2.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-PCR was performed using the QuantiFast SYBR Green OneStep RT-PCR kit (Qiagen, Manchester, UK). PCR primers were ordered from Invitrogen Ltd and ThermoFisher-Scientific (London ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was then used for RT-PCR using the QIAGEN OneStep RT-PCR kit (Qiagen, Germany) at 50°C for 30 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: RT-PCR was performed on the extracted RNA with One-Step RT-PCR kit (Qiagen, #210212) according to the manufacturer’s instructions and the following conditions ...
-
bioRxiv - Cell Biology 2023Quote: Sac2 knockdown was confirmed by quantitative RT-PCR using QuantiTect SYBR Green RT-PCR kit (Qiagen) and the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse transcription-PCR (RT-PCR) was carried out with total RNA using the one-step RT-PCR kit (QIAGEN) according to the supplier’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... using One Step RT-PCR kit (Qiagen, Germany) and its larger portion was amplified for phylogenetic analysis by self designed primers ...
-
bioRxiv - Microbiology 2022Quote: ... QuantiFast SYBR Green RT-PCR Kit (Qiagen, 204156) was used for the qPCR reaction and measurement performed on the 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-PCR products were purified with MinElute PCR Purification Kit (Qiagen). Bulk RT-PCR products were cloned into the barcoded cloning vector and sequenced using the Illumina MiSeq machine ...
-
bioRxiv - Immunology 2021Quote: ... Relative mRNA expression was evaluated by RT-PCR using the QuantiNova SYBR Green RT-PCR Kit (QIAGEN). Primers of selected cytokines and chemokines used in previous studies (27 ...
-
bioRxiv - Microbiology 2021Quote: ... One step RT-PCR was carried out using the QuantiTect probe RT-PCR kit (Qiagen, Valencia, CA) with 500 nM forward and reverse primers and 50 nM labeled probes (DENV2-FAM and ZIKV-FAM and PGK1-VIC TaqMan) ...
-
bioRxiv - Pathology 2021Quote: ... Real-time RT-PCR was performed using the QuantiTect Probe RT-PCR Kit (QuantiTect, Qiagen, Venlo, Netherlands) and a LightCycler 480 (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... BAG2 and ATG101 were amplified by RT-PCR from HEK293T cDNA (Qiagen QuantiTect RT-PCR kit, 205311) using primers oNDS227 and oNDS228 for ATG101 ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR was done with miRCURY LNA RT Kit (Qiagen Cat. No. 339340), adding UniSp6 and cel-miR-39-3p RNA Spike-Ins (Qiagen Cat ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... All PCR reactions were performed using the OneStep RT-PCR Kit (Qiagen) with only very few differences compared to the detection assay ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was synthesised and PCR amplified with Onestep RT-PCR kit (Qiagen). Ighv alleles were amplified using a common variable region primer msVHE (5’GGGAATTCGAGGTGCAGCTGCAGGAGTCTGG3’ ...
-
bioRxiv - Bioengineering 2020Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... using the QuantiTect SYBR Green RT-PCR kit (Qiagen). Cycle conditions were as follows ...
-
bioRxiv - Microbiology 2023Quote: ... or QuantiNova SYBR Green RT-PCR Kit (Qiagen, MD) per manufacturer’s protocol on a QuantStudio 3 (Applied Biosystems ...
-
bioRxiv - Pathology 2021Quote: ... the RT-qPCR reaction was prepared using the OneStep RT-PCR kit (Qiagen, Germany), adjusted to a volume of 12.5 µl with an internal control mastermix ...
-
bioRxiv - Microbiology 2019Quote: ... RT-qPCRs and qPCRs were performed using QuantiTect SYBR Green RT-PCR Kit (Qiagen) respectively with and without RT on a LightCycler 480 (Roche).