Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The next day cells were washed off the plates and plasmids were purified using the HiSpeed Plasmid Maxi kit (Qiagen). The resulting replicate libraries were packaged into a lentiviral library using the packaging vectors psPAX2 and pMD2G and the LV-MAX lentiviral production system (ThermoFisher) ...
-
bioRxiv - Immunology 2022Quote: ... A549-ORF7a and A549-ORF7b cells were seeded (3×10E5) in 6-well plates and lysed using RLT buffer for RNA isolation (RNeasy mini kit, Qiagen). Each sample was performed in triplicate ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was extracted from sub-confluent plates using the RNeasy kit as directed by the manufacturer (Qiagen, Valencia, CA), as previously described (31) ...
-
bioRxiv - Immunology 2022Quote: ... single cells were plated by serial dilution in 96-well plates for clonal selection and gDNA was extracted from the remaining pool using the DNeasy kit (Qiagen). The XBP1 locus was amplified by PCR and sequenced by Sanger sequencing using the primers listed in table S1 ...
-
bioRxiv - Microbiology 2019Quote: A549 or DF-1 cells in 6-well plates were infected with the specified IAVs and total RNA was extracted 8 hpi using a RNeasy Kit (Qiagen). Total RNA was eluted in RNase-free water and stored at −80 °C until needed.
-
bioRxiv - Cell Biology 2019Quote: Confluent FBs from three different donors for each cell type were grown in one well of a 12-well plate and total RNA was purified using the RNeasy Mini Kit (Qiagen) with an on-column DNase treatment ...
-
bioRxiv - Microbiology 2021Quote: DNA extraction from cultured tprAko-SS14 or wild-type strains propagated in 6-well plates following the transformation procedure was performed using the QIAamp mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and were then lysed in the plate using 1 mL of RTL buffer from an AllPrep DNA/RNA/Protein isolation kit (Qiagen). Experiments were performed in triplicate.
-
bioRxiv - Molecular Biology 2022Quote: ... grown up at 20 °C were washed off from NGM plates using M9 solution and subjected to total RNA extraction using the RNeasy Mini Kit from Qiagen. Purification of poly-A containing RNA molecules ...
-
bioRxiv - Cell Biology 2022Quote: ... animals were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using TissueDisruptor and the RNeasy Mini Kit from Qiagen. RNA preparations were used for qRT-PCR or RNAseq ...
-
bioRxiv - Developmental Biology 2022Quote: ... the animals were washed down from NGM plates using M9 solution and subjected to RNA extraction using the RNeasy Mini Kit from Qiagen. 1 μg total RNA from each sample was used for sequencing library construction ...
-
bioRxiv - Genomics 2022Quote: ... Total RNA was purified from single wells of >85% confluent six-well plates using the RNeasy Plus Mini Kit (Qiagen), and an additional DNase I step was used to remove genomic DNA ...
-
bioRxiv - Genetics 2022Quote: ... were maintained at 20 °C and washed down from NGM plates using M9 solution and subjected to RNA extraction using the RNeasy Mini Kit from Qiagen. RNA-seq library preparation and data analysis were performed as previously described 46 ...
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA was purified for sequencing from cells infected in six well plates using a blood and cell culture DNA mini kit (Qiagen). Samples were sequenced at the Northwestern University Genomics Core Facility using NextGen Illumina HiSeq SR500 sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted from ∼70% confluent HeLa cells grown in 6-wells plate using a RNeasy Micro Kit (Qiagen) with a DNase step according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from MU636 and set1 mutant strains growing in plates using the RNeasy Plant Mini Kit (Qiagen) and treated with DNase (Sigma ...
-
bioRxiv - Immunology 2023Quote: Total cellular RNA extraction from cells grown in a 24-well plate was performed using RNeasy Plus kit (Qiagen, # 74034) as per manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... the lawn of bacteria was scraped off the plates and plasmid DNA was prepared using the Plasmid Plus Maxi kit (Qiagen).
-
bioRxiv - Genetics 2023Quote: Genomic DNA of subclones from a 12-well plate along with 2 million parental cells were extracted using DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cells were scraped from each 96-position array selection plate and a pooled plasmid extraction was performed using Plasmid Plus Mini Kit (QIAGEN). The plasmid DNA was quantified and diluted to ∼ 1ng/μL ...
-
bioRxiv - Cell Biology 2023Quote: The entire RNA was isolated from a single well of a 6-well plate using the RNeasy Plus Micro Kit (QIAGEN), following the guidelines provided by the manufacturer ...
-
bioRxiv - Genetics 2023Quote: Total RNA was extracted from 2-week-old seedlings grown on an MS plate using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... but not on BHIY/Thia plates were selected and DNA was isolated using a DNeasy blood and tissue kit (Qiagen) to investigate whether the intended chromosomal mutation was introduced ...
-
bioRxiv - Microbiology 2022Quote: ... LF/LF = 5 mice from two cages over two experiments) using the DNeasy PowerSoil Kit (Qiagen, Germantown, MD). Modifications to the standard protocol included a 10-minute incubation at 65°C immediately following the addition of the lysis buffer and the use of a bead mill homogenizer at 4.5 m/s for 1 min ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA-Seq libraries were prepared from 5 ng total RNA using the NEB Next RNA Ultra Kit (QIAGEN) with poly(A ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from CTLs (days 0, 5 and 7) using the RNeasy Plus Mini Kit (Qiagen. #74136), reverse transcribed to first-strand cDNAs using iScript™ cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA from approximately 25 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2020Quote: ... total DNA from 5 × 105 J-Lat cells was purified using Qiagen blood mini kit (Qiagen, Hilden, Germany) and quantitated spectrophotometrically ...
-
bioRxiv - Cell Biology 2020Quote: ... total RNA was isolated from 5 × 105 cells with the AllPrep© DNA/RNA/Protein Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA for expression analyses was extracted from 5 day-old protonemata using a RNeasy Plant Mini Kit (Qiagen). Genomic DNA removal and cDNA synthesis were performed with a Quantitect Reverse Transcription kit (Qiagen).
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from 5×106 cells per sample using the AllPrep DNA/RNA/miRNA Universal Kit (QIAGEN) according to manufacturer’s recommendations with additional DNase I treatment for RNA extraction ...
-
bioRxiv - Microbiology 2022Quote: DNA was extracted from the Sterivex filters (i.e., 0.22–5 μm size fraction) using an AllPrep DNA/RNA Mini Kit (80204; Qiagen) with a modified protocol ...
-
bioRxiv - Microbiology 2022Quote: RNA was extracted from 5-10 snap-frozen larvae with the RNeasy Mini kit (Qiagen cat no. 74104) and reverse-transcribed using QuantiTect Reverse Transcription kit (Qiagen cat no 205311 ...
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from 5 x 106 T cells using the RNeasy® Mini Kit (Qiagen, Cat. 74106). RNA extraction was performed following the instructions from the “Purification of Total RNA from Animal Cells Using Spin Technology” protocol given in the RNeasy® Mini Handbook ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Immunology 2022Quote: Ni-NTA HisSorb plates (Qiagen) were coated with 50ng/well of S1 proteins (all from Sino Biological ...
-
bioRxiv - Microbiology 2021Quote: Ni-NTA HisSorb plates (Qiagen) were incubated with soluble gH/gL/gO complexes tagged with 6-His overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... using Powerbead Pro Plates (Qiagen) with 0.5mm and 0.1mm ceramic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Neuroscience 2022Quote: E3 and E4 primary microglia were plated at 5×106 cells/well in 6-well plates and RNA was extracted from the cells using the RNEasy Plus Mini Kit (Qiagen #74136) and converted to cDNA using High-Capacity RNA-to-cDNA kit (Thermo #4387406 ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA from cells in a single well of a 6-well plate was isolated using the RNeasy Plus Mini Kit (Qiagen, 74134) according to the manufacturer’s instructions ...