Labshake search
Citations for Qiagen :
251 - 300 of 2034 citations for PD 1 Human 147a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... the PCR fragment and the plasmid fragment without PDS gene were isolated from agarose gel using QIAquick Gel Extraction Kit (Qiagen, catalog number 28706). The digested PCR products and the pBSMVγ plasmid were ligated using T4 ligase (New England BioLabs ...
-
bioRxiv - Biophysics 2021Quote: ... Media containing his-tagged Ecads was passed through a chromatography column containing Ni-NTA agarose beads (Qiagen). Beads were then washed with a pH 7.5 biotinylation buffer (25mM HEPES ...
-
bioRxiv - Synthetic Biology 2021Quote: ... and His-tagged protein was purified from cell lysate using a Ni-NTA spin column (Qiagen, 31014). The resulting product was run on a 12% Bis-Tris PAGE gel (Thermofisher ...
-
bioRxiv - Biophysics 2022Quote: ... Media containing his-tagged Ecads was passed through a chromatography column containing Ni-NTA agarose beads (Qiagen). Beads were then washed with a pH 7.5 biotinylation buffer (25 mM HEPES ...
-
bioRxiv - Molecular Biology 2022Quote: ... The JAK3 PCR fragment was purified and cloned into the pQE-Tri System His-Strep2 vector (Qiagen). The final pQE-JAK3 construct was used to transfect GC using the Xfect transfection kit (Takara Bio ...
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Immunology 2019Quote: His-tag purified recombinant proteins were expressed in E.coli and purified by Ni+-NTA-agarose column (Qiagen). Then ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The plates were coated with 100 μL of 4 μg/mL murine anti-His mAb (Qiagen, #34660), and after blocking ...
-
bioRxiv - Biochemistry 2021Quote: ... His-tagged Sic1PY conjugates (polyubiquitylated Sic1PY, Ubn-Sic1PY) were purified by incubating with Ni-NTA resin (Qiagen) at 4 °C for 1 h ...
-
Maize AFP1 confers antifungal activity by inhibiting chitin deacetylases from a broad range of fungibioRxiv - Microbiology 2021Quote: ... 0.2 µg of AFP1-His proteins was incubated with 20 µl Ni-NTA agarose beads (Qiagen, Germany) in buffer (25 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: ... HIS-tagged DR protein monomers were produced by Hi5 insect cells and purified using Ni-NTA (Qiagen) and size exclusion columns (AKTA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Protein bands were transferred to a nitrocellulose membrane and probed with primary antibodies [mouse anti-His (Qiagen) to detect CAT ...
-
bioRxiv - Biochemistry 2023Quote: ... CBS proteins with a TEV cleavable N-terminal His-tag were purified using Ni-NTA agarose (Qiagen) resin and were treated to gel filtration using a Superose 6 Increase 16/600 column or Superdex 200 Hiload 16/600 column (Cytiva ...
-
bioRxiv - Immunology 2023Quote: ... supernatants were harvested and His-tagged tIgM-Fc (tFcµ) protein was purified using Ni-NTA Agarose (Qiagen) and subsequently ...
-
bioRxiv - Bioengineering 2023Quote: ... Purification of His-tagged GA-MatryoshCaMP6s was performed with Ni-NTA agarose beads (Qiagen, cat. No: 30210). Before applying the lysate ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Biochemistry 2020Quote: ... DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... (2010) using commercial antibodies directed against the His-tag following the instructions of the manufacture (Qiagen, Hilden, Germany).
-
bioRxiv - Microbiology 2020Quote: ... The 6 × his-tagged proteins were purified using a nickel-nitrilotriacetic acid (Ni-NTA) agarose matrix (30250, Qiagen). Cell-free extracts were loaded on 0.5 ml Ni-NTA matrixes and incubated on a roller shaker for 2 h at 4 °C ...
-
bioRxiv - Plant Biology 2020Quote: ... The His-tagged proteins were purified by Ni-affinity gravity-flow chromatography using the Ni-NTA agarose (Qiagen) following the product manual.
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged ubiquitin-conjugated proteins were purified by adding 100 µL of 50 % Ni-NTA agarose beads (Qiagen) equilibrated in A2 buffer to 1 mL of cleared extracts and incubated with rotation for 2-4 hr at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... The SARS-CoV-2 RBD-His protein was purified from cell culture supernatant using a Ni-NTA (Qiagen) affinity column ...
-
bioRxiv - Microbiology 2020Quote: A 6.5 nM concentration of His-tagged 16055 SOSIP.v8.3 trimer in TBS was added to a 96-well Ni-NTA plate (Qiagen) for 2 h at RT ...
-
bioRxiv - Biochemistry 2019Quote: ... DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... His-SFP1 was purified using Ni-NTA affinity purification under native conditions using the standard manufacturer’s protocol (Qiagen). Recombinant His-SFP1 was used to immunize female New Zealand white rabbits (Covalab ...
-
bioRxiv - Bioengineering 2020Quote: Initial small test purifications were performed using Ni-NTA Spin Column for His-Tagged proteins (Qiagen, Hilden, Germany) following the protocol for 6xHis-Tagged Proteins under Native Conditions from E ...
-
bioRxiv - Biochemistry 2020Quote: ... The Ni-NTA agarose resin for purification of his-tagged proteins was purchased from Qiagen (Germantown, MD, USA). Superdex 75 16/600 and Superdex 200 Increase 10/300 size exclusion chromatography columns were purchased from GE Healthcare (Uppsala ...
-
bioRxiv - Biochemistry 2021Quote: DNA constructs were amplified in Escherichia coli DH5α and purified using a Hi-Speed Plasmid Maxi Kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... The N-terminal His-tagged Sif protein (Lmo0946-His6) was expressed and purified using Ni-NTA resin (Qiagen) according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged talin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a gel filtration column (Superdex 200 ...
-
bioRxiv - Biochemistry 2022Quote: ... Lysates of His-tagged vinculin constructs were purified by Ni-NTA-sepharose affinity chromatography (Ni2+-nitrilotriacetic acid, Qiagen), followed by a Q-Sepharose ion exchange column ...
-
bioRxiv - Plant Biology 2024Quote: ... All fractions were analyzed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-His (Qiagen) and anti-strep (MilliporeSigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... The agarose gel bound with the His-tagged recombinant protein was packed in the chromatography column (Qiagen, Germany), and the flow through was discarded ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Biophysics 2021Quote: ... gliding motility assays were performed with specific immobilization of motors on the surface via penta-His antibodies (34660, Qiagen) as previously described[64] (Figure S4) ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant both N-and C-terminally His-tagged proteins were purified using a Ni-NTA Superflow cartridge (1ml, Qiagen) and the Fast Protein Liquid Chromatography (FPLC ...
-
bioRxiv - Cell Biology 2019Quote: ... The recombinant protein was purified with agarose beads that bind specifically to the His-tag (Ni-NTA Agarose, Qiagen) following the purification hybrid method from the ProBond purification system (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Renilla-HA-NOD2 (750 ng/well) and His-FLAG-CAD (250 ng/well) using Effectene Transfection Reagent (Qiagen). The following day ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP ± MirA was loaded onto a column with 80 µL of previously equilibrated Ni-NTA resin (Qiagen) and incubated for 1 h at 4°C with agitation ...
-
bioRxiv - Molecular Biology 2022Quote: His-Prs or its variants (10 µg) were bound to 4 µl of Ni-NTA Magnetic Agarose Beads (Qiagen) in 50 µl interaction buffer (50 mM Tris pH 9.0 ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression levels were validated from the pWB plasmid by western blot using an anti-His HRP conjugate kit (Qiagen) (Fig ...
-
bioRxiv - Immunology 2020Quote: ... ConM-SOSIP.v7 carrying a C-terminal His-tag (diluted to 6.5nM in TBS) was immobilized onto 96-well Ni-NTA ELISA plates (Qiagen) by incubation for 2 hours at room temperature after which the plates were washed 3 times with TBS ...
-
bioRxiv - Biochemistry 2021Quote: ... was transformed with an N-terminally His-tagged fusion protein of cytHPPK/DHPS (At1g69190) in the vector pQE30 (Qiagen). Overnight cultures grown at 30°C in LB broth supplemented with 35 µg/mL kanamycin and 100 µg/mL ampicillin were sub-cultured to an OD600 of 0.6 - 0.7 and induced overnight at 16°C with 100 mM isopropyl β-D-1-thiogalactopyranoside ...
-
bioRxiv - Bioengineering 2020Quote: ... the membrane was incubated with freshly prepared primary antibody solution (1:1,000 dilution for anti-Alix [ab117600, Abcam], anti-Tsg101 [ab30871, Abcam], anti-Calnexin [ab22595, Abcam], anti-His [34660, Qiagen] ...
-
bioRxiv - Microbiology 2022Quote: ... N-terminal His-tagged SlPR1 and SlChi3 proteins were purified using Ni-nitrilotriacetic acid (Ni-NTA) affinity resin (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2019Quote: ... Total RNA was isolated from log-phase bacterial cells grown in the rat peritoneal cavity or in 2.5% NaCl HI broth using the RNeasy minikit (Qiagen). One microgram of purified RNA was converted into cDNA using QuantiTect® Reverse Transcription Kit (Qiagen ...