Labshake search
Citations for Qiagen :
151 - 200 of 2034 citations for PD 1 Human 147a.a HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2020Quote: ... His-tagged Chd1 was purified by Ni-NTA agarose affinity chromatography (Qiagen) and treated with homemade TEV protease to remove the tag ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Molecular Biology 2022Quote: ... the His-SUMO conjugates were enriched using nickel-nitrilotriacetic acid beads (Qiagen). Upon multiple washing steps ...
-
bioRxiv - Biochemistry 2021Quote: ... The primary and secondary antibodies used were anti-penta His (Qiagen #34660) and goat anti-mouse IgG (LiCOR #926-68070 ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse poly-His antibody (cat. no. 34660, QIAGEN) against His tag ...
-
bioRxiv - Biochemistry 2021Quote: ... against Gαs subunit and mouse penta-His antibody (cat. no. 34660, QIAGEN) against His tags ...
-
bioRxiv - Microbiology 2021Quote: ... His-tagged uSpike was purified using Ni-NTA agarose (Qiagen, Germantown, MD) in a gravity flow column ...
-
bioRxiv - Microbiology 2019Quote: ... His-cyAbrB1 was purified with the Ni-NTA Fast Start kit (Qiagen). The elution fractions containing the purified protein were loaded onto a PD MidiTrap G-25 column (GE healthcare ...
-
bioRxiv - Plant Biology 2019Quote: ... His-NaERF2-like were expressed and purified with Ni-NTA agarose (QIAGEN). Biotin labeled probe EM13 (5’-tagattATCTaattctact-3’ ...
-
CHD7 interacts with the nucleosome acidic patch for its efficient activity via its N-terminal regionbioRxiv - Biochemistry 2020Quote: ... His-tagged proteins were purified by Ni-NTA agarose affinity chromatography (Qiagen) and treated with TEV protease to remove the tag ...
-
bioRxiv - Neuroscience 2020Quote: ... His-tagged TEV protease was removed by incubation with Ni-NTA (Qiagen) overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2021Quote: ... His-tagged protein purification was done with Ni-NTA agarose resin (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The His-tagged HTa was purified with Ni-NTA agarose beads (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... His-tagged proteins were purified using a nickel column purification step (QIAGEN). Following IMAC ...
-
bioRxiv - Plant Biology 2021Quote: ... The MBP/His-tagged proteins were purified using Ni2+-NTA agarose (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2020Quote: His-tagged MCP/scFv-GFP was purified with Ni-NTA-agarose (Qiagen) following the manufacturer’s instructions with minor modifications ...
-
bioRxiv - Cell Biology 2020Quote: ... HIS-TRIM39 proteins were purified on Ni-NTA agarose beads (Qiagen, #1018244) and then eluted in a buffer containing 0.5 M imidazole before dialysis in PBS.
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... The His-tagged ACE2 protein was then purified by Ni-NTA (QIAGEN) affinity purification ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tag proteins were purified using a Ni-NTA purification system (Qiagen) by following the specification of the manufacturer ...
-
bioRxiv - Plant Biology 2022Quote: ... and SUMO-HIS-BIN2 protein was purified with Ni-NTA Agarose (Qiagen).
-
bioRxiv - Neuroscience 2023Quote: ... His-tagged VndA was purified over a Nickel-NTA agarose resin (Qiagen) according to manufacturer’s recommendation ...
-
bioRxiv - Biochemistry 2023Quote: ... His-tagged σNS was loaded onto a Ni-NTA agarose column (Qiagen) and eluted using a gradient of 50 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2023Quote: ... a conjugate of mouse monoclonal penta-His antibody and horseradish peroxidase (Qiagen) was used ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged protein was purified on a 1ml Ni-NTA column (Qiagen) prewashed in buffer A containing 500mM imidazole w/o β−mercaptoethanol ...
-
bioRxiv - Biochemistry 2023Quote: ... The 6x-His-tagged proteins were captured using Ni-NTA Superflow (QIAGEN) and the His-tag was cleaved at 4 °C for 16-18 hours by human thrombin (Biopharm laboratories) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the solubilized His-tagged histones were purified using Ni-NTA beads (Qiagen). For untagged H2B ...
-
bioRxiv - Biochemistry 2023Quote: ... and the His-tagged proteins were purified with HisBind NiNTA-agarose (Qiagen) according to the recommendations of the supplier ...
-
bioRxiv - Microbiology 2019Quote: ... Proteins were then stained by Coomassie-blue or immunodetected as described before [26] using primary polyclonal antibodies directed against His6 epitope-tag (Penta His, Qiagen, dilution 1:1000), V5 epitope-tag (Bethyl Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: RNA was isolated from HEK293 cells using the QIAshredder and RNeasy Mini kit (Qiagen, 79654 and 74104, respectively). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: HEK293 cells were seeded in 15 cm plates and transfected after 24h according to manufacturer protocols (Effectene, Qiagen) using 5 µg of plasmid DNA ...
-
bioRxiv - Biophysics 2021Quote: The His-tagged TCF7L2 constructs were affinity purified using Ni-NTA agarose (Qiagen) and the tagged cleaved from the protein using thrombin ...
-
bioRxiv - Microbiology 2019Quote: ... the fusion protein was purified using His-Bind columns (Qiagen, Venlo, The Netherlands) and analyzed by SDS-PAGE using gels containing 12% polyacrylamide ...
-
bioRxiv - Molecular Biology 2021Quote: ... His-tagged proteins were purified on Ni-NTA agarose (Qiagen; catalog no. 30761) and GST-tagged TopBP1 protein was purified on Glutathione Sepharose™ 4B (GE healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... Western blot analysis was performed using the Penta His HRP conjugate kit (Qiagen). To check for equal loading ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Cell Biology 2021Quote: ... The His-tagged TEV protease was removed by incubation with Ni-NTA (Qiagen) overnight at 4°C ...
-
bioRxiv - Biophysics 2019Quote: ... Anti-tetra-His-tag mouse monoclonal antibody (mAb) IgG1 was purchased from Qiagen Com ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant His-tagged GAPDH was purified using Ni-NTA Agarose (Qiagen, Valencia, USA) in native conditions according to the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: Assay mixes consisted of 25 nM ALEXA488-conjugated penta-His antibody (Qiagen # 35310), 50 μM DTT ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-tagged fusion proteins were purified with a Ni-NTA column (Qiagen), and the elution fraction was incubated with TEV protease for 15-18 h at 4°C to cleave the N-terminal His-tag ...
-
bioRxiv - Microbiology 2022Quote: ... His-Hcp was purified from the soluble fraction by NTA-resin chromatography (Qiagen). Purified protein was desalted with a PD-10 desalting column (GE Healthcare ...
-
bioRxiv - Plant Biology 2022Quote: ... Target protein was recovered and purified with a His-Trap affinity column (QIAGEN) according to manufacturers’ protocols ...
-
bioRxiv - Cell Biology 2023Quote: ... Preparation of his-tagged recombinant proteins was performed according to manufacturer instructions (Qiagen). Preparation of GST-tagged recombinant proteins was performed according to manufacturer instructions ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged SLFN11 (residues 349-901) was purified by Ni-NTA beads (Qiagen). All purified GST- or His-tagged proteins were dialyzed against a buffer containing 50 mM Tris-HCl and 150 nM NaCl and validated by Coomassie blue-stained SDSLJPAGE.
-
bioRxiv - Neuroscience 2024Quote: ... The His-tagged nanobodies were purified by using Ni-NTA purification column (Qiagen) followed by desalting step using disposable PD-10 desalting columns (Cytiva ...
-
bioRxiv - Bioengineering 2024Quote: ... Each His-tagged protein in media was captured with Ni-NTA resin (Qiagen) and eluted with DPBS containing 150 mM imidazole.
-
bioRxiv - Cancer Biology 2024Quote: rEDA was produced intracellularly using the pQE-30 His tag purification system (Qiagen) in E ...
-
bioRxiv - Bioengineering 2020Quote: Genomic DNA from mouse tissues and cultured HEK293 cells were extracted using DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD). Total RNA was extracted from mouse tissues and HEK293 cells using Quick-RNA MiniPrep Kit (ZYMO Research ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...