Labshake search
Citations for Qiagen :
251 - 300 of 1673 citations for Mouse Anti Dengue Virus NS1 Serotype 2 Antibody JE1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: Mouse liver RNA was extracted from 10 mg (± 2 mg) of preserved tissue using RNEasy kits and QIAshredders (QIAGEN; Germantown, MD, USA). Aliquots of RNA from each sample were assessed on an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... stored at −20° C and characterized by immnoblotting using mouse anti-2xStrep tag (Qiagen #34850, 1:1,000), and secondary goat anti-mouse IgG IRDye® 800CW (LI-COR # 926-32210 ...
-
bioRxiv - Biochemistry 2022Quote: ... we also probed for the Strep-tag on γTuNA (1:1000 dilution of Strep-tag mouse monoclonal antibody, cat. # 34850, Qiagen). Band intensities were measured in ImageJ and normalized in Prism 7 by the wildtype γTuNA band (positive control) ...
-
bioRxiv - Microbiology 2023Quote: ... Pulled-down fractions were analysed by SDS-PAGE or Western blot using rabbit antibodies against KtrB or mouse against His-tag (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... but with an anti-His antibody (Qiagen, #34660 at a dilution of 1:5000) as primary ...
-
bioRxiv - Microbiology 2021Quote: ... To generate a recombinant A_NS237 virus, viral RNA was extracted from allantoic fluid using Trizol reagent (Thermo Fischer, Germany) and Qiagen RNeasy Kit (Qiagen, Germany) following the manufacturers’ guidelines ...
-
bioRxiv - Genomics 2020Quote: ... Viral RNA was extracted from 300 µl of viral transport media (VTM, Himedia, India) using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: A 200 μL aliquot of Copan UTM® was processed through the QIAsymphony DSP Virus/Pathogen Mini Kit (Qiagen, Cat# 937036) following manufacturer’s instructions on the QIAsymphony SP instrument ...
-
bioRxiv - Molecular Biology 2020Quote: The RNA isolation was performed with 50 µl of the crude extract on the QIAsymphony with the DSP Virus/Pathogen Kit (Qiagen, #937055). The RT-PCR was performed using 5 µl of 85 µl eluate with TIB MolBiol Lightmix® MODULAR SARS AND WUHAN CoV E-Gene Kit ...
-
bioRxiv - Genomics 2020Quote: Viral RNA was extracted from nasopharyngeal swabs of patients with COVID-19 using the EZ1 DSP Virus Kit (Qiagen, Hilden, Germany), optimized for viral and bacterial nucleic acids extractions from human specimens using magnetic bead technology ...
-
bioRxiv - Microbiology 2021Quote: ... we collected the cell culture supernatants after 24 h of infection for viral RNA extraction with a QIAamp 96 Virus QIAcube HT Kit (Qiagen, 57731) and for viral RNA copy number detection in a CFX96 Touch Real-Time PCR Detection System (Bio-Rad Laboratories) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from the lungs of influenza virus-infected mice using the RNeasy Mini Kit (QIAGEN, Cat. No 74004) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Button valves were opened and biotinylated anti-pentaHis antibody (Qiagen, 1:4 dilution in HEPES) was flowed for 30 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... viral RNA was extracted from the egg-isolate of the virus from the nasal swab using the QIAmp viral RNA mini-kit without the addition of carrier RNA (Qiagen, Manchester, UK). cDNA was synthesized from RNA using a random hexamer primer mix and cDNA Synthesis System (Roche ...
-
Host transcriptomic profiling of COVID-19 patients with mild, moderate, and severe clinical outcomesbioRxiv - Genomics 2020Quote: RNA was extracted from nasopharyngeal swabs using the QIAamp Viral RNA Mini or the 213 EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). All patients in this study tested positive for SARS-CoV-2 by RT-qPCR performed at Dubai Health Authority Hospitals ...
-
bioRxiv - Molecular Biology 2020Quote: ... The entire 200-µL reaction was used as input for ssAAV gDNA extraction using a MinElute Virus Spin Kit (Qiagen Cat#57704). 50-ng of ssDNA from each sample were bisulfite converted using the EZ Methylation Gold kit (Zymo Cat#D5005 ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted from virus library and ferret nasal wash samples using the QIAamp® Viral RNA mini kit (Qiagen, Germany). Next generation sequencing was carried out twice on the nasal washes ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 RNA was purified using the QIAamp 96 virus QIAcube HT Kit and processed on the QIAcube robotic extraction platform (QIAgen, Hilden, Germany)
-
bioRxiv - Microbiology 2022Quote: ... A wild-type virus stock NL4-3 was prepared by transfection of the pNL4-3 plasmid (purified using the Qiagen Plasmid Maxikit) into HeLa cells ...
-
bioRxiv - Immunology 2019Quote: ... RNA was isolated from plasma samples using the QIAsymphony Virus/Bacteria Midi kit on the QIAsymphony SP automated sample preparation platform (Qiagen, Hilden, Germany). RNA was extracted manually if plasma volumes were limited ...
-
bioRxiv - Genomics 2020Quote: All 49 COVID-19 patients tested positive for SARS-CoV-2 by RT-qPCR using RNA extracted from nasopharyngeal swabs following the QIAamp Viral RNA Mini or the EZ1 DSP Virus Kits (Qiagen, Hilden, Germany). RNA libraries from all samples were then prepared for shotgun transcriptomic sequencing using the TruSeq Stranded Total RNA Library kit from Illumina (San Diego ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA was extracted from 200 ul of oral swab material using the Qiagen EZ1 DSP Virus kit on the automated EZ1 XL Advance instrument (Qiagen, Valencia, CA). Real-time quantitative reverse transcription – polymerase chain reactions (RT-qPCR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA and DNA were extracted from fecal and urine samples using the QIAamp MinElute Virus Spin Kit (Qiagen, Valencia, CA, USA), but using 20μg of linear polyacrylamide (VWR ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA was extracted from 200 ul of nasopharyngeal swab and BAL material using the Qiagen EZ1 DSP Virus kit on the automated EZ1 XL Advance instrument (Qiagen, Valencia, CA). Real-time quantitative reverse transcription – polymerase chain reactions (RT-qPCR ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from stock virus in allantoic fluid using the QIAamp Viral RNA Mini Kit (Qiagen Inc., Valencia, CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... whereupon DNA was subsequently purified from 200 μl of the lysate using the QIAsymphony DSP Virus/Pathogen extraction kit (Qiagen Cat# 937036) on the QIAsymphony automated platform ...
-
bioRxiv - Molecular Biology 2023Quote: Total viral genomic DNA was extracted from 100 μL stored plasma samples with the QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany), according to manufacturers’ instructions ...
-
bioRxiv - Immunology 2024Quote: Virus RNA from in vitro or in vivo experiments was isolated using the QIAamp® Vira RNA Mini Kit (Qiagen, Germantown, MD) or the MagMAX-96 AI/ND viral RNA isolation kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Viral nucleic acids were then isolated using the Qiagen QIAamp MinElute Virus Spin Kit without the use of AW1 buffer or carrier RNA (Qiagen, Valencia, CA, USA). Random hexamers were used to prime cDNA synthesis (Life Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in 384 well plates on an Applied Biosystems 7900HT Fast Real-Time PCR system using the QuantiTect Virus Kit (Qiagen, Redwood City, CA) and SARS-CoV-CDC RUO primers and probes (Integrated DNA Technologies (IDT) ...
-
bioRxiv - Genomics 2022Quote: ... Nucleic acids were extracted at CNM using either QIAamp MinElute Virus Spin (DNA) or QIAamp Viral RNA Mini kits (Qiagen, Germantown, MD, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... the proteins were transferred to nitrocellulose membranes before being revealed with anti-Histidine monoclonal antibodies (Qiagen). Immune complexes were detected with anti-rabbit peroxidase-conjugated secondary antibodies (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged DmMIC10b was detected using an anti-His antibody (Qiagen N.V., Venlo, The Netherlands, 34660).
-
bioRxiv - Biophysics 2023Quote: ... the glass was additionally treated with biotinylated anti-hexahistidine monoclonal antibody (Penta-His Biotin Conjugate; Qiagen) as in Duchi et al.23 and Dulin et al.31.
-
bioRxiv - Microbiology 2019Quote: ... and Western blot analysis was performed as previously described (30) using a primary anti-his antibody (Qiagen) and a secondary Alexa Fluor 700 goat anti-mouse antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Proteins transferred to a nitrocellulose membrane were probed with a monoclonal anti-His6 antibody (Qiagen, Germantown, Maryland). Detection of proteins via Western blotting was performed by fluorescence detection using IR-Dye®-labeled fluorescent secondary antibodies and imaged using the Odyssey CLx Imager (LICOR Biosciences ...
-
bioRxiv - Microbiology 2023Quote: ... The purified recombinant proteins were analyzed by western-blot with anti-His antibody (1:2000 dilution) (Qiagen) followed by HRP-labeled anti-mouse IgG (1:50000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Nucleic acid was extracted from 200 μl of each sample using the QIAamp MiniElute™ Virus Spin Kit nucleic acid (for DNA and RNA) according to the manufacturer (QIAgen Canada, Toronto, ON, Canada). DNA samples were stored at −80°C and assayed in duplicate by qPCR ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... Mouse Obesity (PAMM- 017ZC-12) array and Mouse Aging (PAMM-178ZC) from Qiagen (Maryland, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence of mouse Donson was amplified from XpressRef Universal Total mouse RNA (QIAGEN, 338114) by RT-PCR (Takara ...
-
bioRxiv - Immunology 2019Quote: ... StrEP-Tag (mouse monoclonal, Qiagen, #34850). Peroxidase-conjugated secondary antibodies against rabbit IgG (#7074 ...
-
bioRxiv - Microbiology 2020Quote: ... mouse β-actin (PPM02945B-200, Qiagen), or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502 ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA against mouse VCP (Qiagen, catalog # ...
-
bioRxiv - Biochemistry 2022Quote: ... A mouse monoclonal His-tetra (Qiagen) antibody (1:1000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... immunodetection of RGS(His)6-tagged 14-3-3 was performed by applying the anti-RGS(His)6 antibody (Qiagen) in combination with a secondary anti-mouse HRP antibody.
-
bioRxiv - Bioengineering 2019Quote: ... the cells were washed once with 0.1% PBSA and incubated with 50 μL of a 1:100 dilution of anti-penta-His Alexa 647 antibody (Qiagen) for 10 minutes on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... The peptide spot membrane was blotted onto a nitrocellulose membrane and UNC-45 binding was probed with an anti-Strep antibody (Qiagen) using an ECL-kit for detection (GE Healthcare).