Labshake search
Citations for Qiagen :
451 - 500 of 1673 citations for Mouse Anti Dengue Virus NS1 Serotype 2 Antibody JE1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... or isolated primary mouse macrophages using RNeasy Mini Kit (Qiagen, Cat# 74106) and reverse-transcribed using High-Capacity cDNA Reverse Transcription Kits (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... were transfected into mouse calvarial osteoblasts using the Effectene transfection reagent (Qiagen). After 48 hours ...
-
bioRxiv - Immunology 2020Quote: ... bulk DNA was isolated from mouse pellets (DNeasy Powersoil Kit, Qiagen, Inc) and attempts were made to amplify a 16S rRNA locus using broad-range (universal ...
-
bioRxiv - Immunology 2019Quote: ... The following mouse primer sets were used from Qiagen (Valencia, CA, USA): TBP (PPM03560F ...
-
bioRxiv - Cell Biology 2021Quote: siRNA for mouse VHL (Flexitube Gene Solution GS22346) was obtained from Qiagen. AllStars negative control siRNA ...
-
bioRxiv - Neuroscience 2020Quote: ... mouse RNA from V1 was extracted using the miRNeasy Mini Kit (Qiagen) based on manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Immunology 2020Quote: A RT2 profiler array for mouse inflammatory cytokines and receptors (Qiagen, USA) was used according to manufacturer recommendations to measure the expression of 84 inflammatory genes (Table S1) ...
-
bioRxiv - Genetics 2022Quote: ... mouse brain and brain region tissues using the miRNeasy kit (QIAGEN, # 217004) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was extracted from mouse cells using the RNeasy Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mouse tissue RNA was extracted using the RNeasy Mini Kit (Qiagen, 74106) following the manufacture’s instruction ...
-
bioRxiv - Genetics 2023Quote: Mouse tissues were either homogenized using QIAzol lysis reagent (Qiagen, Hilden, Germany) in a Tissue Lyser instrument (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... A mouse Yy1-specific siRNA or the AllStars Negative Control siRNA (Qiagen) was co-transfected with an L1 promoter reporter plasmid using Lipofectamine 3000 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Biochemistry 2022Quote: ... Penta-His Antibody (Qiagen, 34660, IB: 1:1000) and Y188 to APP C-terminus (Abcam ...
-
bioRxiv - Biochemistry 2021Quote: ... analysed by western-blotting using Penta·His Antibody (QIAGEN), of wild-type OxlT measured on the same day of experiment ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies (α-His HRP conjugated (Qiagen 34460) or α -VSV-G (Millipore sigma V4888-200UG) ...
-
bioRxiv - Immunology 2019Quote: ... Primary mouse CD4+ T cells were purified from lymph nodes and spleens by negative selection using anti-MHCII and anti-CD8 hybridoma supernatants (M5/114 and 2.43, respectively) and anti-rat Ig magnetic beads (Qiagen BioMag). The resulting CD4+ T cells were then immediately activated on 24-well plates coated with anti-CD3 and anti-CD28 (1 ug/ml each ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... miRCURY LNA Power Inhibitor against mouse miR-375 (mmu-miR-375-3p) (Qiagen, Hilden ...
-
bioRxiv - Genetics 2021Quote: ... Total RNA was extracted from mouse liver samples using RNeasy Mini Kit (Qiagen), DNase treated and 1 μg total RNA was processed for mRNA sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Pre-weighed cortex pieces from mouse brains were homogenized in QIAzol (Qiagen 79306), at 1ml volume per 100mg of tissue ...
-
bioRxiv - Physiology 2020Quote: Total RNA was isolated from mouse tissues using QIAzol Lysis Reagent Protocol (QIAGEN) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA of mouse islets was extracted using RNeasy Plus Mini Kit (Qiagen). Other tissues including mouse liver ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was extracted from mouse right adrenals using the RNeasy mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the RNA from mouse liver was isolated using RNeasy Mini Kit (Qiagen, 74104) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: We analyzed human and mouse Tug1 cDNA sequences with CLC Genomics Workbench (Qiagen) for open reading frames (ORFs) ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... we prepared total RNA from dissected wildtype mouse brain regions using Qiazol (Qiagen) and prepared cDNA using the SuperScript III first-strand synthesis kit (Invitrogen) ...
-
bioRxiv - Genetics 2019Quote: Total RNA was extracted from mouse pituitaries using an RNeasy mini kit (Qiagen) and 250 ng converted to cDNA using Revertra Ace (TOYOBO ...