Labshake search
Citations for Qiagen :
151 - 200 of 1017 citations for L Valine 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The pellet from the first centrifugation was resuspended in 200 µL of PBS and DNA was isolated using the cultured cells protocol of the Dneasy Blood and tissue Kit (Qiagen). The second pellet ...
-
bioRxiv - Microbiology 2024Quote: ... was resuspended in 200 µL of PBS and DNA was isolated using the gram-positive protocol of the Dneasy Blood and tissue Kit (Qiagen). For each isolation ...
-
bioRxiv - Developmental Biology 2020Quote: ... 100 μl of chloroform was added and mixed vigorously and the aqueous component was isolated using MaXtract High Density tubes (Qiagen, 129046) using the manufacturers protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA was extracted from 200 μl conditioned medium or 100 μl foetal plasma using the miRNeasy Mini Kit and the miRNeasy Serum/Plasma Kit (Qiagen, Germany). microRNA expression levels were analysed using the nCounter Rat v1.5 miRNA Expression Assay (NanoString Technologies ...
-
bioRxiv - Genetics 2021Quote: ... incubated overnight at 37°C in L-broth containing 50 ng/μL ampicillin and DNA isolated using the QIAprep Spin Miniprep kit (Qiagen 27104) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 3.5 μl of cDNA was used as template and amplified in a total volume of 40 μl with a mix of forward L-VH primers (Table S1) and reverse Cγ primer and using the HotStar® Taq DNA polymerase (Qiagen) and 50 cycles of PCR (94°C 30 s ...
-
bioRxiv - Developmental Biology 2022Quote: ... The resulting 1.5 L bacterial culture was incubated at 37°C for 2h and a Maxiprep performed using Qiagen MaxiPlus kit (Qiagen #12963) to a resulting 1 mg of plasmid DNA ...
-
bioRxiv - Immunology 2023Quote: ... 3.5 μl of cDNA was used as template and amplified in a total volume of 40 μl with a mix of forward L-VH primers (Table S3) and reverse Cγ primer and using the HotStar® Taq DNA polymerase (Qiagen) and 50 cycles of PCR (94°C 30 s ...
-
bioRxiv - Molecular Biology 2019Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA synthesis was performed using RT^2 First Strand Kit (Qiagen) and run on the RT^2 First Strand Kit (Stem cell PCR array ...
-
bioRxiv - Molecular Biology 2019Quote: ... tumefaciens culture was added to 2 ml RNAprotect Bacteria Reagent (Qiagen) and RNA was isolated using RNeasy columns (Qiagen) ...
-
bioRxiv - Genomics 2021Quote: ... Pooled libraries were diluted to 2 nM in EB buffer (Qiagen) and then denatured using the Illumina protocol ...
-
bioRxiv - Microbiology 2021Quote: ... In replicates 1 and 2 a Universal extraction robot (Qiagen, Germany) and associated nucleic acid extraction (Qiagen ...
-
bioRxiv - Plant Biology 2021Quote: ... Supernatant was mixed with 2 mL of Ni-NTA agarose (Qiagen) on a rotary shaker for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and finally eluted in 2 x 30 μL EB Buffer (Qiagen) at 60°C.
-
bioRxiv - Genomics 2020Quote: ... or (ii) QIAseq SARS-CoV-2 Primer Panel (Qiagen GmbH, Germany) for amplified of viral genome sequencing or (iii ...
-
bioRxiv - Biochemistry 2021Quote: ... and then stirred with 2 ml Ni-NTA Superflow resin (Qiagen) that had been pre-equilibrated with Buffer A for 10 min on ice ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were collected into 2 ml round bottom microcentrifuge tubes (Qiagen) and weighed prior to freezing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cleared lysate was incubated with 2 mL Ni-NTA agarose (Qiagen) for 1 hr and washed with 50 mL wash buffer (1X PNI ...
-
bioRxiv - Immunology 2022Quote: ... 2 μg/ml TPCK-trypsin) using a Tissue Lyser II (Qiagen) with the following program ...
-
bioRxiv - Synthetic Biology 2022Quote: ... This mixture was diluted a further 2× into an Omniscript (Qiagen) RT reaction following the manufacturer’s instructions and incubated at 50°C for 20 min followed by heat inactivation at 95°C for 2 min ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cleared lysates were incubated with 2-4ml nickel NTA beads (Qiagen) for 20-40 minutes before washing beads with 5-10 column volumes of lysis buffer ...
-
bioRxiv - Immunology 2023Quote: ... starting from step 2 of the RNeasy micro kit (Qiagen, #74004) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... The supernatant was mixed with 2 ml Ni-NTA agarose (Qiagen) pre-equilibrated in lysis buffer ...
-
bioRxiv - Microbiology 2023Quote: EHEC cultures were mixed with 2 volumes of RNAprotect reagent (Qiagen), incubated at room temperature for 5 minutes and harvested by centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... and eIF3B – C 2: GACCGACTTGAGAAACTCAAA) were synthesized by QIAGEN (Hilden, Germany). For transfection ...
-
bioRxiv - Microbiology 2024Quote: ... The columns were put on new 2 mL collection tubes (Qiagen) and centrifuged at 15000 rpm for 1 min to dry the columns ...
-
bioRxiv - Microbiology 2024Quote: ... using a 2 ml Tube Holder Set (QIAGEN; Cat. No. 11993), and DNA extractions were eluted with C6 Elution Buffer in a final volume of 80 µl ...
-
bioRxiv - Microbiology 2024Quote: ... cleared lysates were incubated with 2 mL Ni-NTA agarose (Qiagen) on a rotator for 1 hour at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... Up to ∼2 million cells were resuspended in 100 μl High-TE buffer (10 mM Tris-Cl, pH 8, 10 mM EDTA, 25-100 μg/ml RNase A (QIAGEN, Cat. # 19101)) and lysed by adding 2.5 μl 20% SDS ...
-
bioRxiv - Microbiology 2022Quote: 200 μl of apical wash was harvested at 48 and 72 hpi and 100 μl inactivated in 400 l AVL buffer (Qiagen, Hombrechtikon, Switzerland) for 10 min at RT then 400 μl of absolute ethanol were added to each sample ...
-
bioRxiv - Neuroscience 2020Quote: ... 500 μl ethanol and 500 μl corn oil were added to 50 mg tamoxifen and mixed in a tissue lyser (Qiagen, Hilden, Germany) for 10 min at 50 Hertz ...
-
bioRxiv - Microbiology 2021Quote: ... total genomic DNA was extracted from a culture grown on R2B with 200 mg/L BAM using the DNeasy UltraClean Microbial Kit (Qiagen, Hilden, Germany). Afterwards ...
-
bioRxiv - Microbiology 2020Quote: ... of a 6-well plate in 200 μL ice-cold PBS + 10% Proteinase K and processed through the DNeasy Blood and Tissue Kit following manufacture protocols (QIAGEN, Hilden, Germany). gDNA was stored at −20° C for short-term storage or −80° C for long-term storage.
-
bioRxiv - Microbiology 2022Quote: ... of a 6-well plate in 200 μL ice-cold PBS + 10% Proteinase K and processed through the DNeasy Blood and Tissue Kit following manufacture protocols (QIAGEN, Hilden, Germany). gDNA was stored at -20° C for short-term storage or -80° C for long-term storage.
-
bioRxiv - Molecular Biology 2022Quote: ... An aliquot of cells was diluted to OD600 0.3 and 500 µL of diluted cells was added to 1 mL of RNAprotect Bacteria Reagent provided in the RNeasy Mini Kit (Qiagen; catalog #74104). Protocols provided in the “RNAprotect Bacteria Reagent Handbook 2015” were used for RNA extraction (“Protocol 1”) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... DNA removal was performed by applying 80 μl of DNase I working solution (10 μL DNase stock + 70 μL 1x RDD buffer; RNase-Free DNase Set, Qiagen, Hilden, Germany) to the column and incubated for 15 min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... The first round of PCR was carried out using the ImmunoSEQ proprietary PCR primer mix (32 μL per sample containing 25 uL of QIAGEN 2× Multiplex PCR Master Mix, 5μL of QIAGEN 5x Q-solution and 2 μL of primer mix). A positive control reaction ...
-
bioRxiv - Plant Biology 2020Quote: ... at 65°C overnight and treated with 2 μg RNase A (Qiagen) for 1h at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Generation of cDNA was performed by GoTaq 2-step RT system (Qiagen). Real-time PCR reactions were measured by ABI StepOnePlus system using SYBR green qPCR master mix (ThermoFisher) ...
-
bioRxiv - Microbiology 2019Quote: The Microbial DNA qPCR Array Intestinal Infection 2 kit (Qiagen, Hilden, Germany) (Supplementary table 1 ...
-
bioRxiv - Immunology 2019Quote: ... pelleted and lysed in RLT Plus buffer supplemented with 2-mercaptoethanol (Qiagen). The RNeasy Plus Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tubes were shaken at maximum speed (30) for 2 min (Qiagen Tissuelyser), vortexed ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 2-mercaptoethanol and purified using the RNeasy Micro kit (Qiagen).
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis-tagged CDK-2 was purified using Ni-NTA resins (Qiagen 30210) and eluted in PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... nks1-1 and nks1-2 using RNeasy Plant mini kit (74904, QIAGEN). cDNA was synthesized from 1 μg total RNA using iScript cDNA synthesis kit (1706691 ...
-
bioRxiv - Microbiology 2020Quote: ... except that 2 mL prefilled bead tubes (Qiagen; catalog no., 13118-50) were used for the bead beating ...
-
bioRxiv - Plant Biology 2019Quote: ... treated with 2 mL of RNAprotect bacteria reagent (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions and the samples flash-frozen in liquid nitrogen and stored at −80 °C until further use ...
-
bioRxiv - Microbiology 2019Quote: ... and high-speed shaking in a TissueLyzer device (2 minutes, 30Hz; QIAGEN). Samples were stored at −20°C.
-
bioRxiv - Microbiology 2022Quote: ... (2) PCR purification was conducted using the QIAquick PCR Purification Kit (Qiagen), and (3 ...