Labshake search
Citations for Qiagen :
1 - 50 of 1017 citations for L Valine 2 13C 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 99% Buffer TCL (Qiagen, cat# 1031576), sealed with perfluorinated oil (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2022Quote: ... combined with Ni-NTA resin (2 mL/1 L of biomass, Qiagen) pre-equilibrated with 40 mM sodium phosphate buffer ...
-
bioRxiv - Microbiology 2022Quote: ... and 150 μL DMEM supplemented with 2% FBS and homogenized using a TissueLyser II (2 cycles at 30 Hz, 1 min, Qiagen). Homogenates were clarified by centrifugation and frozen until plaque assay titration ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from 0.25 g of soil from all segments from two of the five 13C soil cores using the DNeasy PowerSoil DNA Extraction kit (Qiagen, Hilden, Germany) to determine the segment with the highest abundance of methanogens or methanotrophs based on the respective functional marker genes using qPCR as described below ...
-
bioRxiv - Genomics 2022Quote: ... 32 μl Master Mix containing 30 μl MDA reaction buffer and 2 μl Phi29 polymerase (REPLI-g UltraFast Mini Kit; Qiagen) were added ...
-
bioRxiv - Genetics 2021Quote: ... Genomic DNA was extracted from the red blood cells of the parents and 99 F2 hybrid females using the DNeasy Blood & Tissue Kit (Qiagen). The library was constructed according to a previously described method [27] ...
-
bioRxiv - Immunology 2023Quote: ... 120 mg l− 1 sodium pyruvate and 1% penicillin–streptomycin) at 300 Hz for 2 minutes using a TissueLyser II (Qiagen, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... 2.8□l of forward and reverse primer at 5□M concentration and 10□l QuantiNova (Qiagen), made up to a final volume of 20□l with nuclease-free water ...
-
bioRxiv - Systems Biology 2021Quote: ... and 200 L of Buffer AL (QIAGEN) were added to each sample before mixing with a pipette ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... trigynum (Sample size: L. tenue thrum=6, pin=4, L. trigynum homostyle=5) using the RNeasy Plant Mini Kit (QIAGEN, Germany). Libraries were sequenced on an Illumina NovaSeq S1 Sequencing System to produce paired-end 150bp read length reads ...
-
bioRxiv - Immunology 2022Quote: ... T6BP (L-016892-00-0020 Dharmacon or SI02781296, Qiagen), CANX (SI02663367 and SI02757300 ...
-
bioRxiv - Systems Biology 2022Quote: ... FABP (horizon L-042923-01-0005) and HIF1α (Qiagen SI00193032 ...
-
bioRxiv - Microbiology 2020Quote: ... 0.01% L-tryptophan) using the RNeasy Mini kit (Qiagen). Ten μg of total RNA was hybridized to 150 nM 32P 5’-end-labeled DNA oligonucleotide complementary to nucleotides +94 to +109 (relative to yfmHG transcription ...
-
bioRxiv - Genetics 2022Quote: ... Quantified libraries (GeneRead DNA Library L Core Kit; QIAGEN) were sequenced using an Ion Torrent S5 XL instrument with Ion 530 chips and respective reagents (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were homogenized in 180 l of ATL Buffer (Qiagen) with ~20 1-mm glass beads (BioSpec ...
-
bioRxiv - Microbiology 2019Quote: ... 0.125 μl Taq DNA Polymerase (5 units/L, Qiagen, Hilden, Germany) and 1 μl of DNA template ...
-
bioRxiv - Genetics 2020Quote: ... and adapter ligating (T4 DNA Ligase #L603-HC-L, Enzymatics/Qiagen). Final cleanup and size selection was performed using 1-part DNA ...
-
bioRxiv - Biochemistry 2021Quote: ... then supplemented with 15 mL/L settled Ni-NTA resin (Qiagen) at a scale of 12 L ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
bioRxiv - Cancer Biology 2019Quote: ... 12 μL of 20 μmol/L negative control siRNA (QIAGEN, Germantown, MD) or Hs_MAN1B1 siRNA (QIAGEN ...
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2022Quote: ... supernatant was combined with Ni-NTA resin (1 mL/1 L of biomass, Qiagen) pre-equilibrated with 20 mM HEPES ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl of inner PCR product was added to 2 μl 10x PCR buffer (Qiagen, Cat# 203203), 0.4 μl of 10 μM dNTP mix ...
-
bioRxiv - Microbiology 2022Quote: ... of the hamsters at 2 dpi or 2 days post-exposure (exposed naïve) using RNeasy kit (Qiagen) for viral load quantification and calculation of the Omicron:Delta ratio ...
-
bioRxiv - Systems Biology 2021Quote: ... 2 mL samples were mixed into glass tubes containing 2 volumes of RNAprotect bacteria reagent solution (Qiagen). After mixing and incubating for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: SARS-CoV-2 whole-genome sequencing was performed by using QIAseq DIRECT SARS-CoV-2 Kit (QIAGEN). The quality of paired-end reads obtained from MiSeq sequencing was analyzed by using Qiagen CLC Genomics Workbench 22.0.1 and the Identify ARTIC V3 SARS-CoV-2 Low Frequency and Shared Variants (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’, Qiagen), si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA #2: 5’-AGCGACTGAGCCGCTATAATA-3’ (SI04232011, Qiagen); #3 ...