Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Human Rh Blood Group D Antigen RHD CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... using DNeasy Blood & Tissue Kit (Qiagen, Germany, Hilden) with some modification ...
-
bioRxiv - Physiology 2024Quote: ... DNeasy Blood & Tissue Kits were used (QIAGEN #69506). After extraction ...
-
bioRxiv - Molecular Biology 2024Quote: ... from genomic DNA (Qiagen blood and tissue kit) using primers BFP_F:atggtgagcaagggcga BFP_R:ggcatggacgagctgtacaag or SNCA_F ...
-
bioRxiv - Immunology 2023Quote: ... was isolated using DNeasy Blood & Tissue Kit (QIAGEN) according to manufacturer’s protocol and normalized using NanoDrop (ThermoFischer Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... DNeasy Blood & Tissue Kit and QIAamp DNA FFPE Tissue Kit (Qiagen) were used for Genomic DNA extraction of paired FF and FFPE samples respectively.
-
bioRxiv - Genomics 2022Quote: Total RNA from whole blood stored in PAXgene Blood RNA tubes was extracted using the PaxGene Blood miRNA kit (Qiagen, Hilden, Germany). Quality of RNA was assessed using a Bioanalyzer (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA was extracted by whole blood collected on PAXgene™ Blood RNA tubes (Becton Dickinson) by the PAXgene™ Blood RNA Kit (Qiagen). The High Capacity cDNA Reverse Transcription Kit (Applied Biosystem ...
-
bioRxiv - Microbiology 2022Quote: ... and 12-days post infection (3 samples/group) using the RNeasy Kit (Qiagen). Samples were processed at the Baylor College of Medicine Genomic and RNA Expression Profiling Core (Houston ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (5 mice per group) was extracted using RNeasy Micro Kit (QIAGEN). Samples were sent to Admera Health for sequencing and analysis ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were gel purified using QIAquick Gel Extraction Kits (Qiagen Group, USA), and ‘TOPO-cloned’ into pCR2.1 TOPO vectors (TOPO TA Cloning Kit ...
-
bioRxiv - Cancer Biology 2019Quote: DNA was isolated using the QIAamp DNA Blood Mini Kit and the DNeasy Blood & Tissue Kit (both from Qiagen, Hilden, Germany).
-
bioRxiv - Genetics 2021Quote: Genomic DNA was extracted from peripheral blood of all 395 participants using the genomic DNA extraction kit QIAamp DNA Blood Mini Kit (Qiagen, Germany). The selected genomic DNA regions for the analysis of each gene included the most common reported SNPs (For NAT2 ...
-
bioRxiv - Molecular Biology 2023Quote: QIAamp DNA Blood Mini Kit (for whole blood, buffy coat and plasma) and QIAamp DNA Mini Kit for lesion scraping (Qiagen, Germany) were used for DNA extraction as per the manufacturer’s protocols except elution in 50μl elution buffer AE (10 mM Tris-Cl ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Genomic DNA was extracted from the thoracic muscle tissue of each individual using either the QIAamp 96 DNA Blood Kit or the DNeasy Blood & Tissue Kits (Qiagen, LLC). Libraries were prepared for low-coverage whole genome sequencing (2×150 bp reads ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted from venous blood using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). All samples underwent Genetic Eye Disease test (GEDi ...
-
bioRxiv - Genomics 2019Quote: ... RNA was isolated from whole blood using the PAXgene® Blood RNA kit (Qiagen, Valencia, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from venous blood using the DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany). OGI-081-197 underwent GEDi sequencing as described previously 42 ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from EDTA anticoagulated blood with the DNeasy® Blood and Tissue Kit (Qiagen) following the manufacturer’s protocol with a few modifications.10 The initial blood volume for DNA extraction was 100μL ...
-
bioRxiv - Neuroscience 2022Quote: Genomic DNAs were extracted from peripheral venous blood samples using QIAamp DNA Blood Midi Kit (Qiagen). Genomic DNA samples were amplified with the illustra GenomiPhi V2 DNA Amplification Kit (GE Healthcare) ...
-
bioRxiv - Cancer Biology 2022Quote: DNA was isolated from organoids and blood using the DNeasy Blood and Tissue kit (Qiagen, 69504) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... DNA was extracted from blood using Puregene whole-blood extraction kit (Qiagen Inc., Valencia, CA, USA) or hair samples using previously published methods [59] ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... or FTA-dried blood spot samples (n = 26) using the QIAamp DNA Blood Mini Kit (Qiagen). For fecal samples ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was extracted from the blood pellet using DNeasy Blood and Tissue kit (QIAGEN, 69506). PCR was performed on the extracted DNA samples to amplify the B ...
-
bioRxiv - Cancer Biology 2021Quote: Total DNA from splenic tissue and whole blood was extracted using DNeasy Blood & Tissue Kit (QIAGEN) and NucliSENS (bioMérieux) ...
-
bioRxiv - Microbiology 2020Quote: ... blood and organs of the pigs using the DNeasy Blood &Tissue kit (Qiagen GmbH, Hilden, Germany). DNA was quantified using a NanoDrop ND-1000 (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... we purified DNA from 50 μL blood using a DNeasy Blood and Tissue Kit (Qiagen, Australia), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: RNA was prepared from blood (250 µl) of individual mice using QIAmp RNA Blood kit (Qiagen) and NucleoSpin RNA blood kit (Macherey Nagel) ...
-
bioRxiv - Genetics 2023Quote: ... DNA was extracted from whole blood using the Qiagen DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... From blood and tissue samples DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) or the MagAttract HMW DNA kit (Qiagen ...
-
bioRxiv - Genomics 2022Quote: DNA from blood was isolated using QIAamp DNA Blood Mini Kit (Qiagen, Cat No./ID: 51104) as per manufacturer’s instruction ...
-
bioRxiv - Genetics 2023Quote: Genomic DNA was extracted from lysed peripheral blood samples using the DNeasy Blood & Tissue Kit (Qiagen) for genotyping ...
-
bioRxiv - Genomics 2024Quote: Genomic DNA was extracted from blood using a MagAttract Blood DNA/RNA Kit (Qiagen, Venlo, Netherlands) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... DNA was extracted from the Paxgene Blood DNA tubes using the Paxgene Blood DNA kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... blood samples were stored in PAXgene Blood RNA Tubes and RNA was extracted using the PAXgene Blood RNA Kit (Qiagen, Venlo, The Netherlands) by deCODE Genetics ...
-
bioRxiv - Genetics 2020Quote: ... according to the DNeasy Blood & Tissue kit and DNeasy Micro kit (QIAGEN). Total RNA was extracted from pelleted cells using the Rneasy Mini kit (QIAGEN ...
-
bioRxiv - Cell Biology 2023Quote: DNA was extracted using a commercial kit (DNeasy Blood & Tissue kit, Qiagen). For cDNA ...
-
bioRxiv - Genomics 2021Quote: ... using the DNEasy Blood and Tissue kit (69504, Qiagen). E ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA was extracted with Blood & Tissue Kit (Qiagen), and the variable ends were sequenced with the Sanger method using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2020Quote: We used the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer’s instructions to extract DNA for SNP analysis ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the DNeasy Blood & Tissue Kit (QIAGEN, Valencia, CA) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: The QIAmp DNA Blood Mini Kit (Qiagen, cat.: 51106) was used to extract genomic DNA (gDNA ...
-
bioRxiv - Immunology 2022Quote: ... DNA was extracted using DNeasy blood/tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... and BXD40 using the DNeasy Blood & Tissue Kit (Qiagen) from frozen liver or spleen tissue ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... urticae populations using DNeasy Blood & Tissue kit (QIAGEN®). The quantity and quality of gDNA extracted were determined using nanodrop ...
-
bioRxiv - Genetics 2020Quote: ... RNA was isolated using the Blood RNEasy kit (Qiagen) and RT-PCR was performed as described previously described (Carlson et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... falciparum cultures using the QIAamp DNA blood kit (Qiagen). Constructs utilized in this study were confirmed by sequencing ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... we used the DNeasy Blood and Tissue kit (Qiagen). We pooled our 350 triple-hybrids by simultaneously by freezing all samples in liquid nitrogen and grinding them together with a mortar and pestle ...
-
bioRxiv - Microbiology 2020Quote: ... was extracted using DNeasy Blood and tissue kit (Qiagen). TLR9 expression analysis was performed by total cell RNA extraction using an RNEASY RNA isolation kit (74104 ...
-
bioRxiv - Genomics 2021Quote: ... RNA was isolated using PAXgene Blood miRNA kits (Qiagen) following the protocol provided with the kit that included an on-column DNase treatment ...
-
bioRxiv - Neuroscience 2021Quote: ... Qiagen DNeasy Blood and Tissue Kits (Qiagen, Manchester, UK) were used to extract genomic DNA (gDNA ...