Labshake search
Citations for Qiagen :
1 - 50 of 10000+ citations for Human Rh Blood Group D Antigen RHD CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... CH-ME49 cysts and RH strain tachyzoites using the DNeasy Blood % Tissue Purification Kit (Qiagen). The cytochrome b coding sequences were amplified from genomic DNA and cDNA by PCR with primers 5’ATGGTTTCGAGAACACTCAGT ...
-
bioRxiv - Genomics 2020Quote: ... gondii RH Δ ku80 using RNeasy Mini Kit (Qiagen) following manufacturer’s Quick-Start protocol with the DNase digestion step ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from blood (n=6 for each housing group) using the RNeasy Protect Animal Blood Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) from human blood cells was isolated using the QIAamp Blood kit (QIAGEN, Hilden, Germany). To isolate gDNA from different mouse tissues we made use of the blackPREP Rodent Tail DNA Kit (Analytik Jena ...
-
bioRxiv - Immunology 2019Quote: ... Genomic human DNA was isolated from whole blood using QIAamp DNA Blood Mini Kit from Qiagen (51106) and phosphodiester DNA from TIB Molbiol ...
-
bioRxiv - Bioengineering 2019Quote: ... Genomic DNA was extracted from an individual mosquito of each progeny group using the DNeasy Blood & Tissue Kit (QIAGEN) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total genomic DNA was extracted from all Trim28-KO and control groups using DNeasy blood and tissue kit (Qiagen) and a 1.5 kb fragment surrounding the different target sequences were amplified by PCR (primers can be found in supplementary table 2 ...
-
bioRxiv - Genomics 2019Quote: ... and human genomic DNA (extracted from cells with DNeasy Blood & Tissue Kit, Qiagen). One guide was used with the plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Microbiology 2020Quote: ... Total Genomic DNA was isolated from the parasites recovered from LmWT and LmCen-/- plus DXM treated group according to the manufacturer information (DNeasy Blood & Tissue Kit, Qiagen). PCR was performed with L ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for blood (n=3-4 for MEL077 and n=6-7 for MP46 per treatment group) using the QIAamp DNA Blood Mini kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... in each treatment group the sorted samples were processed for genomic DNA isolation using the QIAamp DNA blood maxi kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... rodent tissues and human samples using the Qiagen Blood and Tissue Kit (Qiagen, USA). The procedures prior to protein digestion were as follows ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Molecular Biology 2023Quote: Total DNA was extracted from mouse parotid gland tissue (n=5/group) following the manufacturer’s protocol for DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). Mitochondrial DNA (mtDNA ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was isolated from snap-frozen cortico-hippocampal brain sections from NTG and APP/PS1 mice treated with vehicle or CP2 (n = 5 per group) for 14 months using a DNeasy Blood & Tissue Kit (QIAGEN, cat. # 69504) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: gDNA samples from the unselected control (gDNACtrl) and 2nd (gDNAScreen) selected group cells were extracted using the Blood and Cell Culture DNA Midi Kit (#13343; QIAGEN, Germantown, MD).
-
bioRxiv - Molecular Biology 2023Quote: Parotid glands were removed from mice (n=5/group) and total DNA was immediately isolated using the DNeasy Blood & Tissue Kit (Ref. No. 69504, Qiagen, Hilden, Germany). DNA samples were diluted with nuclease-free water to a concentration of 10 ng/uL ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic DNA was extracted combining a lysozyme method and the D-neasy blood tissue kit (Qiagen). The product was purified by the PCR purification kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... and Marine Benthic Group – D in the Thermoplasmata (with the latter for core 32 only) using the Quantifast SYBRGreen kit (Qiagen) on a BioRad Opticon2 thermocycler ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: ... 1mL of whole blood was collected directly in QFT Gold tubes (Nil, TB Antigens, Mitogen) (Qiagen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from human and murine PC cells were isolated using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was purified from human peripheral blood mononuclear cells (PBMCs) using QIAamp kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... Cells were processed for DNA using the manufacturer’s protocol from Qiagen DNeasy Blood & Tissue Kit (Qiagen). Concentration and 260/280 ratio of the final product was measured using a NanoDrop Spectrophotometer (ThermoFisher).
-
bioRxiv - Microbiology 2022Quote: ... DNeasy Blood & Tissue Kit (Qiagen) or QiaAmp DNA QIAcube HT Kit for 96-well sample plates were used to extract DNA from B ...
-
bioRxiv - Microbiology 2019Quote: ... DNeasy Blood & Tissue Kit (QIAGEN) was used to extract DNA from the activated sludge samples ...
-
bioRxiv - Bioengineering 2020Quote: ... DNeasy Blood & Tissue Kit (Qiagen) was used for the extraction and purification of HPV DNA from the cell pellets ...
-
bioRxiv - Genomics 2020Quote: ... Gentra Puregene Blood Kit (Qiagen) was used to extract genomic DNA from blood ...
-
bioRxiv - Microbiology 2023Quote: ... DNeasy Blood & Tissue Kits (Qiagen) was used to isolate chromosomal DNA from P ...
-
bioRxiv - Genomics 2024Quote: ... QIAamp DNA Blood Kits (Qiagen) was used to extract genomic DNA from PBMC ...
-
bioRxiv - Immunology 2021Quote: ... Whole blood was lysed using the Gentra Puregene Blood Kit (Qiagen). Also ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was isolated from blood (QiaAmp DNA Mini Blood Kit, Qiagen; or Monarch Genomic DNA purification kit ...
-
bioRxiv - Cancer Biology 2023Quote: ... and from blood by using either DNeasy Blood & Tissue Kit (Qiagen) or Maxwell® RSC Blood DNA Kit ...
-
bioRxiv - Microbiology 2023Quote: ... Human DNA from whole cell extracts of A549 cells was purified using the DNeasy Blood and Tissue kit (Qiagen). RNAseA (Thermo ...
-
bioRxiv - Genomics 2020Quote: ... blood or liver samples using the DNeasy Blood and Tissue Kit (Qiagen). Murine DNA was isolated from ear snip after Proteinase K digestion using standard phenol/chloroform protocol ...
-
bioRxiv - Genomics 2020Quote: ... Blood RNA was purified with the RNeasy Protect Animal Blood Kit (Qiagen). Kidney and heart samples were treated with proteinase K before extraction ...
-
bioRxiv - Genetics 2023Quote: ... blood or myocardium samples using the DNeasy Blood and Tissue Kit (Qiagen). DNA quality was controlled by electrophoresis and quantified using a Nanodrop spectrophotometer.
-
bioRxiv - Genomics 2019Quote: ... FSM sub-groups and 12 rats in the CS sub-group) using the RNeasy Plus Mini Kit (Qiagen, Hilden Germany). RNA extraction ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Microbiology 2020Quote: DNeasy blood and tissue kit (Qiagen) and sent for whole genome sequencing at the Mutualized platform for Microbiology of Institut Pasteur.
-
bioRxiv - Cancer Biology 2022Quote: ... QIAamp DNA Blood Maxi Kit (Qiagen) was used following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.). The DNA quality was visualized in 1% agarose gel electrophoresis ...
-
bioRxiv - Microbiology 2019Quote: ... the DNeasy Blood & Tissue Kit (Qiagen). High-quality DNA is required for optimal restriction endonuclease digestion and is of utmost importance for the overall success of the protocol ...
-
bioRxiv - Genomics 2021Quote: DNeasy Blood and Tissue Kit (Qiagen) and Quick-DNA Universal Kit (Zymo Research ...
-
bioRxiv - Microbiology 2020Quote: ... and DNeasy Blood & Tissue kit (Qiagen), respectively ...
-
bioRxiv - Microbiology 2020Quote: ... the DNeasy Blood & Tissue kit (QIAGEN) was used following the instructions of the manufacturer with the following modifications ...