Labshake search
Citations for Qiagen :
701 - 750 of 1798 citations for Human PLA2G4F shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... then purified with QIAGEN Plasmid Plus Midi Kit (QIAGEN, 12943). Mutations were confirmed by sanger sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using the IRES-rev primer (TATAGACAAACGCACACCG) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The plasmids of these colonies were purified via miniprep (Qiagen) and sequenced by SNPsaurus ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids and DNA fragments were purified using commercial kits (Qiagen). Elim Biopharmaceuticals synthesized custom oligonucleotides and provided Sanger DNA sequencing services.
-
bioRxiv - Cancer Biology 2023Quote: ... NR0B2 overexpressing plasmid was delivered using Effectine transfection reagent (Qiagen). All transfections were conducted in accordance with the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Vectors were isolated using the plasmid miniprep kit (Qiagen, Germany). pURR expression vectors were transformed into E ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid libraries were recovered using a Midi prep kit (Qiagen). Lentiviral libraries were generated in HEK293T by transfection of plasmid libraries using lipofectamine 2000 (ThermoScientific ...
-
bioRxiv - Immunology 2023Quote: ... The plasmids were purified using QIAprep Spin Miniprep Kit (Qiagen), and their sequences were confirmed by Sanger sequencing (Genewiz) ...
-
bioRxiv - Genomics 2023Quote: ... plasmids miniprepped with the QIAprep® Spin Miniprep Kit (QIAGEN) and sequenced on both strands using pJET1.2 primers.
-
bioRxiv - Cell Biology 2022Quote: ... Plasmid DNA was prepared using the Mini Prep kit (Qiagen). Transgenic animals expressing an extrachromosomal array were created by gonadal microinjection of plasmids of interest with indicated co-injection marker into indicated strains in Table S6 ...
-
bioRxiv - Developmental Biology 2023Quote: Plasmids were purified using a MaxiPrep DNA isolation Kit (Qiagen). For virus packaging ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids were purified using the QIAprep Spin Miniprep Kit (QIAGEN), and individual clones were sequenced at Microsynth using a forward primer (GGCAAACAACAGATGGCTGGCAAC ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids were amplified with the QIAprep Spin miniprep kit (Qiagen) and linearized with Not1-HF (New England Biolabs) ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids were isolated using a bacterial miniprep kit (Qiagen, 27106). Nanobody sequences were determined by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... plasmids were extracted using a QIAprep Spin Miniprep Kit (QIAGEN) and the correct sequences were confirmed by Sanger sequencing.
-
bioRxiv - Cancer Biology 2023Quote: ... with the plasmid as per instructions and isolated by QIAGEN HiSpeed Plasmid Midi Kit (QIAGEN ...
-
bioRxiv - Neuroscience 2024Quote: ... QIAfilter Plasmid kits (Midi prep kit; Qiagen; catalog no.: 12243) were utilized to purify plasmid DNAs following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids were extracted using QIAprep Spin Miniprep Kit (27106, Qiagen) and transformed into competent MG1655.
-
bioRxiv - Neuroscience 2023Quote: ... 16 µg of plasmid and 15 µL of Effectene (Qiagen). Cells were collected after 48 hours and prepared for the RNA-IP experiment ...
-
bioRxiv - Molecular Biology 2023Quote: ... Linearized plasmid was purified using Qiaprep Spin Miniprep Kit (Qiagen). For T7-based in vitro transcription ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA was extracted using a Qiagen plasmid mini kit (Qiagen). Confirmation of the correct constructs was performed with Sanger Sequencing via Azenta/GENEWIZ (Azenta Life Sciences Inc.).
-
bioRxiv - Bioengineering 2023Quote: ... Plasmid- and DNA-gel extractions were done with kits (Qiagen) as per manufacturer’s protocols ...
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... The construct library was extracted using plasmid Maxi kit (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... Plasmid DNA was isolated using QIAprep miniprep kit (Qiagen, Germany). All constructs were confirmed by sequencing ...
-
bioRxiv - Genomics 2023Quote: ... coli cultures using the EndoFree Plasmid Maxi Kit (Qiagen #12362). Low passage number (≤ passage 10 ...
-
bioRxiv - Microbiology 2023Quote: Plasmids used for protein purification were based on pQE70 (Qiagen). For purification of EsaDEG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Plasmids were purified using a QIAprep Spin Miniprep kit (Qiagen).
-
bioRxiv - Microbiology 2024Quote: ... Plasmid DNA was isolated using QIAprep Spin Miniprep Kit (Qiagen) or Nucleospin Plasmid Kit (Macherey-Nagel) ...
-
bioRxiv - Genomics 2023Quote: ... Plasmid DNA (pDNA) was prepared (QIAprep Spin Miniprep Kit, Qiagen). Purified plasmids were sequence confirmed by restriction enzyme digests and whole plasmid sequencing.
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were purified using the Spin MiniPrep kit (Qiagen 27104) per manufacturer’s instruction with the following modification for S ...
-
bioRxiv - Molecular Biology 2024Quote: ... and midi-prepped using a Plasmid Plus Midi kit (Qiagen) per manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Plasmids were sequence verified and purified with midi prep (Qiagen). Plasmids with gRNA vectors were sent for injection (completed by Genome Prolab Inc ...
-
Bacteria Are a Major Determinant of Orsay Virus Transmission and Infection in Caenorhabditis elegansbioRxiv - Microbiology 2024Quote: ... Plasmids were then obtained using a Qiagen MiniPrep Kit (Qiagen). Plasmids were assessed for the desired sequence by Sanger sequencing and transformed into P ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Plasmid DNAs were purified using the Qiaprep spin Miniprep (Qiagen) and verified by Sanger sequencing using internal gene-specific and vector primers to ensure overlapping sequence information in both forward and reverse directions ...
-
bioRxiv - Neuroscience 2021Quote: ... astrocytes and human brain tissue using the RNeasy Mini kit (Qiagen) and reverse transcribed using the High-Capacity RNA-to-cDNA kit (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: The Human Cancer Stem Cells RT² Profiler PCR Array from Qiagen was used to profile the expression of 84 genes linked to cancer stem cells (CSCs ...
-
bioRxiv - Cancer Biology 2022Quote: Human EMT qPCR arrays were purchased from Qiagen (Cat. #: PAHS-021Z), performed as described using RNA from PDX mammary tumors grown in SOFT and STIFF Col1/rBM hydrogels ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA for experiments was obtained using endotoxin-free plasmid purification kits (NucleoBond Xtra Midi EF, Takara, cat. 740420.10 or Qiagen EndoFree Plasmid Maxi Kit, cat. 12362); concentration and purity were assessed with spectrophotometry and agarose electrophoresis.
-
bioRxiv - Neuroscience 2023Quote: pEGFP-N1 plasmid expressing full-length rat FGF-AS gene (a generous gift from Dr. Paul Murphy, Dalhousie University, Canada) was purified as endotoxin-free plasmids (Qiagen, endo-free plasmid Maxi-kit). To facilitate the in vivo delivery of the plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... His- tagged human UHRF1 was purified using Ni-NTA sepharose resin (Qiagen). Recombinant E1 (His-UBE1) ...
-
bioRxiv - Genetics 2022Quote: RNA from human ileal biopsies was extracted using RNeasy Mini Kit (Qiagen). 500 ng of RNA was reverse transcribed to cDNA using TaqMan Reverse Transcription kit (#N8080234 ...
-
bioRxiv - Cell Biology 2022Quote: FASTQ files generated by sequencing human macrophages were imported into ArrayStudio (Qiagen). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... Samples were applied to the Human Aging RT2 Profiler PCR arrays (Qiagen) and run on Bio-Rad CFX384 real time thermocycler ...
-
bioRxiv - Molecular Biology 2019Quote: Human islet RNA was extracted using the Qiagen RNeasy Kit (Qiagen; #74106) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... human sputum cells or mouse lung tissue using an RNeasy kit (Qiagen). 2μg was utilised for cDNA synthesis using the Omniscript RT kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: Human skin tissues were homogenized with RLT buffer (Qiagen, Hilden, Germany, 79216) supplemented with 1% β-mercaptoethanol (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers for human ZMPSTE24 Hs_ZMPSTE24_1_SG QuantiTect) were predesigned and validated by QIAGEN and used diluted to a final work solution of 1x (QuantiTect Primers ...
-
bioRxiv - Developmental Biology 2023Quote: FlexiTube siRNA was used to knock-down human PDE2A (Cat#: SI00040159, Qiagen). AllStars Negative CTRL siRNA was used as control (Cat# ...
-
bioRxiv - Cell Biology 2024Quote: ... serially diluted matching human PCR amplicons cloned into the pDrive vector (Qiagen) were used to generate a standard curve ...
-
bioRxiv - Plant Biology 2020Quote: ... coli cells grown overnight at 30°C (Plasmid Mini Kit, QIAGEN), and its concentration measured by nanodrop ...