Labshake search
Citations for Qiagen :
351 - 400 of 10000+ citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... RNA was also extracted from human first and second trimester placental villi using the RNeasy Plus Universal Mini Kit (Qiagen). Libraries were made using the Illumina TruSeq Stranded mRNA Library Kit according to the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2022Quote: qRT-PCR of SARS-Cov-2 RNA was performed as previously described.59 RNA was extracted from human lung epithelial cells expressing human ACE2 (A549-hACE2) grown in 96-well plates by using the RNeasy 96 Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... total RNA from normal human or AIL patient neutrophils was isolated using RNeasy Total RNA Isolation Kit (Qiagen, GmBH, Germany)/ TRIzol reagent (Life technologies ...
-
bioRxiv - Physiology 2023Quote: Cytokines secreted from nonapoptotic and apoptotic NCTC cells were screened with the Human Inflammatory Cytokines Multi-Analyte ELISArray Kit (QIAGEN). Nonapoptotic and apoptotic NCTC cell supernatants were prepared in replicate serial dilutions of the Antigen Standard ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA was extracted from sorted cells and from two replicated of in vitro cultured E-A14 cells stabilized in RLT buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Micro Kit (Qiagen). The SMARTer Ultra Low Input RNA Kit for Sequencing v4 (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA from the human cell lines and mouse tumor samples was extracted using RNeasy Plus Mini Kits (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Total RNA was extracted from whole lungs from IAV non-infected / infected mice and human PBMCs using (RNeasy mini kit, Qiagen). RNA quantity and purity were assessed using a spectrophotometer (NanoDrop) ...
-
bioRxiv - Developmental Biology 2024Quote: ... total RNA was extracted from newly acquired human embryonic/fetal brain samples (n=32) using the AllPrep DNA/RNA Mini Kit (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: Total RNAs were extracted from human benign prostatic cells using RNeasy Mini Kit as per manufacture’s protocol (Qiagen, Cat # 74104). cDNA was synthesized using 2µg of RNA using a high-capacity RNA to cDNA kit (applied biosystems ...
-
Immune profiling in M. tuberculosis infection enables stratification of patients with active diseasebioRxiv - Immunology 2019Quote: Supernatants from QFT and TruC tubes were analyzed for IFNγ by standard ELISA (Qiagen) and values were expressed in IU/mL ...
-
bioRxiv - Microbiology 2019Quote: ... 1 ml RLT buffer (Qiagen RNA Isolation Kit) + 10 μl β-mercaptoethanol was added and vortexed and a phenol chloroform extraction followed by an ethanol precipitation was carried out ...
-
bioRxiv - Cell Biology 2021Quote: ... human myosin-18A (synthesized by Qiagen)
-
bioRxiv - Cancer Biology 2022Quote: ... three kits were used: (1) Qiagen DNeasy Blood & Tissue Kits (Qiagen, cat. no. 69504) for DNA extraction and (2 ...
-
bioRxiv - Plant Biology 2021Quote: ... we mapped DNA-seq read data to sequenced H1706 tomato genome itag 3.0 to identify SNPs using CLC Genomics Workbench 11 (QIAGEN, https://www.qiagenbioinformatics.com/). Next ...
-
bioRxiv - Neuroscience 2022Quote: ... and the reminder 45 nt sequences were aligned to the GRCh38 Mus-Musculus reference genome (Ensembl rel. 97) using the CLC Genomics Workbench (CLC Bio) (v.20, QIAGEN Bioinformatics). An eight-nucleotide UMI tag and mapping coordinates were used to remove PCR-duplicate reads ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using the QIAseq SARS-CoV-2 Primer Panel V2 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Genomics 2020Quote: The SARS-Co-V-2 viral target genome amplicon libraries were constructed using QIAseq SARS-CoV-2 Primer Panel V1 (Qiagen, Germany) coupled with QIAseq FX DNA library kit (Qiagen ...
-
bioRxiv - Biochemistry 2022Quote: ... Trimming of the obtained sequencing reads and mapping to the pea aphid genome (version 3) were performed with the program CLC Genomics Workbench (Qiagen Bioinformatics) (mapping parameter ...
-
bioRxiv - Microbiology 2022Quote: ... Single contigs were obtained for all six genomes by de novo assembly using the CLC Genomics Workbench version 20 (QIAGEN Bioinformatics) with default settings ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human U6 primer used in this experiment was included in the miScript Primer assay kit (Qiagen Inc., Germantown, MD, #218300).
-
bioRxiv - Developmental Biology 2021Quote: RNA was isolated from a 23 week human fetal heart using Trizol-based dissociation followed by the RNEasy Mini Kit (Qiagen #74104). cDNA was created from this RNA using the iScript Reverse Transcription Supermix (Bio-Rad #1708840) ...
-
bioRxiv - Systems Biology 2022Quote: DNA was isolated from human buffy coat samples at the Crimson Core facility (Mass General Brigham) using the QIAamp DNA Blood Mini Kit (Qiagen 69504) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Reference plasmids were serially diluted in either PBS buffer or heat-inactivated normal human serum (NHS) and re-extracted using the QIAamp® DNA Blood Mini Kit (Qiagen) per recommended protocol for serum ...
-
bioRxiv - Molecular Biology 2022Quote: Genomic DNA was extracted from human cell lines of WI-38 and MED13LS1497F using DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: RNA was extracted from a SARS-CoV-2 Omicron BA.1 clinical isolate (SARS-CoV-2/human/USA/CA-CDC-4358237-001/2021) (GenBank: OM264909.1) using the QIAamp Viral RNA kit (Qiagen, Hilden, Germany). The complete wild-type Omicron genome was then reverse transcribed via RT-PCR with SuperScript™ IV First-Strand Synthesis System (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... 1 µg of RNA isolated from human islets or 10 µL of exosomal RNA was reverse transcribed using the miRScript II kit (Qiagen, Germany), following manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... genomic DNA was extracted from the proteinase K-digested tail tips of mouse or peripheral blood mononuclear cell (PBMC) of human donors using DNeasy blood tissue kit (Qiagen, #69506). 25 ng of genomic DNA was subjected to bisulfite conversion using a commercial kit (Zymo Research ...
-
bioRxiv - Genomics 2023Quote: ... gracilis (1 male and 1 female) using the Rneasy Mini Plant Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Genetics 2022Quote: ... and extracted and amplified from vitrified blastocysts by thawing in phosphate-buffered saline supplemented with 5% bovine serum albumin and processing with REPLI-g whole genome amplification methods (Qiagen, Cat. #150343). Informed consent was obtained from all participants (custodians of the blastocysts ...
-
bioRxiv - Genomics 2022Quote: RNA-seq data analyses were carried out using the raw sequencing reads and mapped on the assembled genome by CLC Genomics Workbench v22 software (Qiagen Bioinformatics, USA) for each tissue/population separately ...
-
bioRxiv - Neuroscience 2019Quote: ... Pathway analyses performed using the Kyoto Encyclopedia of Genes and Genomes (KEGG) database as well as using Ingenuity Pathway Analysis software (IPA; Qiagen, Hilden, Germany). RNA-sequencing data files have been deposited in the NCBI Sequence Read Archive (SRA ...
-
bioRxiv - Genomics 2023Quote: ... Then the FASTQ files were used to map the reads using the genome ID#KP188547 as reference in the CLC genomics workbench (Qiagen, Hilden, Germany) [14] ...
-
bioRxiv - Neuroscience 2019Quote: ... total RNA from magnetically purified human NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 4) hiPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, and PSEN1A246E (replicates, n = 3) human iPSC-derived neurons was prepared using miRNeasy Micro Kit (Qiagen Cat. 217084), based on manufacturer’s procedures ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA from magnetically purified NDC, PSEN1M146L, PSEN1A246E, and PSEN1H163R (replicates, n = 3) human iPSC-derived neurons was prepared using RNeasy Plus Micro Kit (Qiagen, Cat. 74034) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Genomic DNA was extracted from 2×105 primary human lung fibroblasts harvested in passage 3 using QIAamp Micro Kit (Qiagen, Hilden, Germany) following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA was isolated from cultured from human bronchial epithelial cells / mice right lung tissues and purified using the Qiagen AllPrep DNA/RNA Mini Kit (Qiagen, Hilden, Germany), supplemented with the Proteinase K (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... we extracted whole blood DNA from all individuals included in the RNA sequencing data using Gentra® Puregene® for human whole blood kit (QIAGEN) and MagAttract® HMW DNA kit (QIAGEN ...
-
bioRxiv - Genetics 2019Quote: Total RNA from human cell lines (PTC-05, HepG2 and HEK-293T) was extracted using spin columns with the RNeasy Mini Kit (QIAGEN, GmbH, Germany) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA from Amborella generative cells and sperm cells was extracted according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out by using the ‘Human Innate and Adaptive immune Response’ kit (Qiagen, Hilden, Germany) to assess the expression of genes/mRNA ...
-
bioRxiv - Molecular Biology 2023Quote: ... A total of 1 ng of RNA from microdissected human pancreatic islets and from EndoC-βH1 was used to generate cDNA libraries using QiaSeq miRNA library kit (Qiagen, Hilden, Germany) following manufacturer’s instructions (see ESM Methods).
-
bioRxiv - Neuroscience 2024Quote: Total RNA was extracted from FACS sorted mouse brain cells stabilized in RNAprotect buffer according to the “Purification of total RNA from animal and human cells” protocol of the RNeasy Plus Micro Kit (QIAGEN, Hilden, Germany). In brief ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Filling of the genome-wide protruding ends of the restriction digestions were quantified in a pyrosequencing reaction (PyroMark Q48 autoprep, Qiagen, dispensation order: ACTCGA) and all results were analyzed with the associated software (Q48 Autoprep Software).