Labshake search
Citations for Qiagen :
251 - 300 of 10000+ citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Genomics 2020Quote: We assembled the H3 and H4 genomes independently using CLC Genomics Workbench version 8.0.1 (Qiagen, https://digitalinsights.qiagen.com), incorporating the Microbial Genome Finishing Module (https://digitalinsights.qiagen.com/plugins/clc-genome-finishing-module/) ...
-
bioRxiv - Microbiology 2020Quote: ... In silico AvrII (BlnI) restriction digests of selected genomes was carried out in CLC Genomics Workbench (Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: De novo genome assembly was performed for each individual using CLC Genomics Workbench v8.5.1 (QIAGEN Aarhus, Denmark). All trimmed read pairs from the short-insert libraries were used for assembly under the following parameter settings ...
-
bioRxiv - Neuroscience 2021Quote: ... DNAm level of the two investigated CpG sites (hg19 reference genome coordinates: chr22:19,950,054-19,950,064) was quantified using the PyroMark Q24 Software 2.0 (Qiagen, Hilden, GER). Each sample was analyzed twice and the mean percentage was used for further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... the Sarbecovirus genomes identified were verified and corrected by iterative mapping using CLC Assembly Cell v5.1.0 (QIAGEN). Aligned reads were manually inspected using Geneious prime v2020.1.2 (2020 ...
-
bioRxiv - Microbiology 2022Quote: ... trimmed reads were mapped to the KSHV genome (GenBank accession number NC_009333) using the map-to- reference tool on CLC Genomics Workbench v20.0.3 (Qiagen) with default parameters ...
-
bioRxiv - Plant Biology 2022Quote: ... Reads were assembled using the barley reference genome (Mascher et al., 2017) with CLC Genomics (Qiagen, Netherlands). Normalised read counts (transcripts per million ...
-
bioRxiv - Microbiology 2023Quote: ... with mycobacterial genome-directed primers.60 The qPCRs were run in the Corbett Rotor-Gene 6000 (Qiagen) using the 2×SYBR green master mix (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... and reads were aligned to the mouse reference genome Refseq GRCm39.105 from the Biomedical Genomics Analysis Plugin 20.0.1 (Qiagen). Normalization of RNA-seq data was performed using trimmed mean of M-values ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Sequences were mapped to the reference genomes and mutations were identified using CLC Genomic Workbench software (Qiagen). The extent of DNA amplification was estimated by dividing the average sequence coverage of the amplifications by the average sequence coverage of the rest of the chromosome in CLC Genomic Workbench (Qiagen ...
-
bioRxiv - Bioengineering 2021Quote: Genomic DNA from human primary CD4+/CD8+ T cells was isolated using the Gentra Puregene Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) from human blood cells was isolated using the QIAamp Blood kit (QIAGEN, Hilden, Germany). To isolate gDNA from different mouse tissues we made use of the blackPREP Rodent Tail DNA Kit (Analytik Jena ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from human and murine PC cells were isolated using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Genomic human DNA was isolated from whole blood using QIAamp DNA Blood Mini Kit from Qiagen (51106) and phosphodiester DNA from TIB Molbiol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Genetics 2019Quote: RNA was extracted from PCYT1A-wild-type human fibroblasts using the RNeasy Mini Kit (Qiagen, Cat#74104), reverse-transcribed according to the manufacturer’s protocol (SuperScriptIII One-Step RT-PCR system with Platinum Taq DNA Polymerase;Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA of human macrophages was isolated according to manufacturer’s instructions using the RNeasy extraction kit (Qiagen). mRNA was extracted using the Next Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using the RNeasy extraction kit (Qiagen). Two µg of RNA each was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was purified from human peripheral blood mononuclear cells (PBMCs) using QIAamp kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen, Hilden, Germany) or TRIzol reagent (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2024Quote: The RNA quality of human kidney FFPE sample was checked by RNeasy FFPE kit (Qiagen-Cat #73504) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA from 1205Lu cells and immortalized human melanocytes were isolated and purified using RNeasy Micro Kit (Qiagen) according to manufacturer’s instruction and concentration was quantified using a NanoDrop Spectrophotometer (ThermoScientific) ...
-
bioRxiv - Genomics 2024Quote: ... the effect of human rRNA removal was also assessed using a QIAseq FastSelect rRNA removal kit (Qiagen). The rRNA removal reaction was performed after RNA thermal denaturation at 95℃ 5 min according to the instructions.
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Immunology 2019Quote: ... Reads were mapped to the reference genome sequence of Mus musculus from GRCm38 (RefSeq) using the CLC Genomics Workbench 8.0.1 (Qiagen). Relative transcript expression was calculated by counting the Reads Per Kilobase of exon model per Million mapped reads (RPKM) ...
-
bioRxiv - Genetics 2019Quote: ... Reads were mapped against the reference genome of strain S288C and variants detected using CLC Genomics Workbench (Qiagen).
-
bioRxiv - Genomics 2022Quote: Genomic DNA was extracted from the young leaves of each tree species using Genome-tips (Qiagen, Hilden, Germany). DNA concentration was measured using the Qubit dsDNA BR assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... Reads were trimmed and aligned to the BLS256 reference genome (NC_017267) using CLC Genomics Workbench (CLC-Bio/Qiagen). Data are deposited in NCBI under BioProject number PRJNA915483.
-
bioRxiv - Developmental Biology 2022Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as transcript per million mapped reads (TPM ...
-
bioRxiv - Microbiology 2023Quote: ... Phylogenetic analysis of all Agtevirus phages was performed using whole genomes sequence in CLC genomics version 22 (Qiagen) with default settings (date 04/01-23) ...
-
bioRxiv - Genomics 2023Quote: Genome DNA was extracted from the young leaves of Micro-Tom lines using Genomic Tip (Qiagen, Hilden, Germany). The extracted DNA was sheared into 30 kb fragments using Megaruptor 2 (Diagenode ...
-
bioRxiv - Developmental Biology 2023Quote: ... Reads from *.fastq files were mapped to the rat reference genome (Ensembl Rnor_5.0.78) using CLC Genomics Workbench 12.0 (Qiagen, Germantown, MD). Transcript abundance was expressed as reads per kilobase of transcript per million reads mapped (RPKM ...
-
bioRxiv - Microbiology 2019Quote: Microbial genomic DNA was extracted from the human stool samples using the DNeasy PowerSoil DNA Isolation Kit (Qiagen). The V4 region of 16S rRNA gene was amplified and sequenced using the Illumina MiSeq platform(67) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human HDL (40nM) or PBS for 48 hours prior to RNA isolation using the RNeasy Mini kit (Qiagen). RNA samples were converted to cDNA libraries by the Northwestern University Genomics Core facility and were then run on the Illumina HT-12 microarray ...
-
bioRxiv - Microbiology 2021Quote: ... Cell-free cfDNA (both human and mouse) was isolated with QIAamp DSP Circulation NA Kit (QIAGEN, Hilden, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from 22 human vaginal samples using the QIAamp UCP Pathogen Mini Kit (QIAGEN, Venlo, Netherlands) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... genomic DNA from murine or human monocytes was isolated using AllPrep DNA/RNA/miRNA Universal Kit (Qiagen, 80224). DNA (1 µg ...
-
bioRxiv - Neuroscience 2021Quote: The total RNA from mouse cortex and human PBMC was extracted using the RNeasy® Mini Kit (Qiagen) and real-time PCR was done as described in the Supplementary material.
-
bioRxiv - Neuroscience 2020Quote: ... RNA was isolated from human autopsy brain tissue using the RNeasy Plus Universal Mini Kit (Qiagen Cat# 73404).
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from cells or human or mouse brain tissues using RNeasy Mini kit (Qiagen, 74106). Reverse transcription was carried out using iScript Reverse Transcription Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... Bulk gDNA and RNA from human retinal organoids were isolated using the AllPrep DNA/RNA Micro Kit (Qiagen) or DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was collected from treated human or murine primary spinal cord astrocytes using an RNeasy Kit (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was extracted from human glioblastoma cells using the RNeasy kit according to the manufacturer’s instructions (Qiagen). RNA quality was assessed on a Bioanalyzer (Agilent ...
-
bioRxiv - Pathology 2023Quote: Total RNA was extracted from the frozen human stomach tissues using the RNeasy plus Mini Kit (Qiagen, US) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA from the human biopsy samples and mice colon tissue was isolated using RNeasy mini kit (Qiagen) according to the manufacturer’s protocol ...