Labshake search
Citations for Qiagen :
201 - 250 of 2656 citations for Human Immunodeficiency Virus Gag Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Viral genomic RNA was purified from 280 μL virus-containing media using the QIAamp Viral RNA Mini Kit (Qiagen) as per the manufacturer’s instructions and eluted in 60 μL nuclease-free water ...
-
bioRxiv - Microbiology 2023Quote: We extracted influenza virus genomic RNA from the clarified allantoic fluid using the QIAamp Viral RNA Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and viral RNA was extracted using an EZ1 Advanced XL robot with the EZ1 mini virus 2.0 kit (both from Qiagen) and linear acrylamide (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2020Quote: ... and B cells) using the Qiagen AllPrep RNA/DNA kit (Qiagen, CA, USA). 500ng of DNA from each sample was treated with sodium bisulfite ...
-
bioRxiv - Immunology 2019Quote: RNA was extracted from sorted B cells subpopulations using the RNeasy kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was isolated from mouse B cells using the DNeasy kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... aureus genomic DNA was purified using the Puregene yeast/bacteria kit B (Qiagen). Lysostaphin ...
-
bioRxiv - Immunology 2023Quote: ... B cell lysis and RNA extraction were performed using the RNeasy Kit (Qiagen), with the quality and concentration measured using Nanodrop (Thermo Fisher Scientific).
-
bioRxiv - Immunology 2023Quote: ... Remaining B cells were lysed and mRNA was extracted using TurboCapture plates (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved B cells using the DNeasy Blood & Tissue Kit (Qiagen, cat # 69506). The Carrington Lab (National Cancer Institute ...
-
bioRxiv - Bioengineering 2020Quote: ... each SeraCare panel member was diluted 1:10 in human plasma to a final volume of 100μL and processed by QIAGEN QIAamp viral mini kit ...
-
bioRxiv - Microbiology 2020Quote: ... RNA from one aliquot per condition per virus isolate and negative control was immediately extracted with the QIAamp Viral RNA Mini Kit (Qiagen) and stored at −80°C until further processing ...
-
bioRxiv - Microbiology 2021Quote: Total RNA of each isolate was extracted from frozen virus stock using QIAamp Viral RNA Mini Kit (Qiagen, Germantown, MD) following the manufacturers spin protocol ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA was extracted from the working stock of each reporter virus and treated with DNase using the DNase Max kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: 200µL of lung clarified homogenate or infectious cell supernatant (virus stock) was inactivated with an equal volume of VXL lysis buffer (Qiagen) and viral RNA was extracted using an EZ1 Advanced XL robot with the EZ1 mini virus 2.0 kit (both from Qiagen ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted from 70 μL of supernatant using QIAamp 96 virus QIAcube HT kit on the QIAcube HT System (Qiagen). Each RNA sample was analyzed by one-step RT-qPCR with two SYBR Green assays ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was extracted from supernatants of swab material using the QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Total Nucleic Acid (TNA) was extracted from using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). Autopsy tissues were collected from lung ...
-
bioRxiv - Microbiology 2019Quote: For viral genome copy measurements RNA was extracted from 2 µl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from supernatants of hamster nasal wash samples using the QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). Real time RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA extraction was performed on an EZ1 Advanced XL device using the EZ1 virus mini kit V2.0 according to the manufacturer’s recommendations (Qiagen, Courtaboeuf, France). The qPCR was run on a Lightcycler® 480 thermocycler (Roche diagnostics ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from cell culture supernatants or hamster nasal washes using the QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: Total viral RNA was extracted from deactivated samples using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (QIAGEN). One step reverse transcription to cDNA and real-time PCR (RT-PCR ...
-
bioRxiv - Microbiology 2020Quote: ... EAV genome copy number was determined by one step RT-qPCR using the QuantiTect™ Virus + ROX Vial Kit (Qiagen). Each RNA sample was tested in triplicate ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA from the original material used for next-generation sequencing of the serum and passage 3 cultured MRI103 virus was used as the template for amplification using the One-Step Ahead RT-PCR kit (Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... virus pellets were resuspended by vortexing and community DNA was extracted using the QIAamp Viral RNA Mini Kit (Qiagen, Germany) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed with a primer set targeting partial regions of the ORF1b gene in the SARS-CoV-2 virus using the QIAGEN OneStep RT-PCR kit (Qiagen) as previously reported (51) ...
-
bioRxiv - Genomics 2021Quote: ... Total Nucleic Acid (TNA) was extracted using automated nucleic acid extraction on the QIAsymphony and the DSP Virus/Pathogen Mini Kit (Qiagen). RNA isolation and library preparation is fully described in Butler ...
-
bioRxiv - Immunology 2022Quote: ... we isolated viral RNA directly from the Fluenz Tetra vaccine (AstraZeneca; season 2017/2018) virus using the Qiagen Viral RNA Isolation Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The cells were cultured in growth media containing virus for 60 hours and total RNA was then extracted with the RNeasy kit (Qiagen). From the total RNA ...
-
bioRxiv - Microbiology 2023Quote: Total genomic DNA from the bacteriophages and bacterial isolates was extracted using QIAamp UltraSens Virus kit (Qiagen catalog number 53706) and DNeasy Blood & Tissue Kit (Qiagen catalog number 69504 ...
-
bioRxiv - Systems Biology 2023Quote: Viral RNA was extracted from specimens using the QIAamp Viral RNA Minikit and the QIAamp 96 Virus QIAcube HT Kit (Qiagen). Viral transport media (VTM)-only controls were included in each extraction ...
-
bioRxiv - Microbiology 2023Quote: DNase/RNase treated VLPs were used for genomic DNA extraction using Qiagen QIAamp DSP Virus Spin Kit (Qiagen, MD, U.S.A) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted from 140 µl of each sample and also from the original virus dilutions with the “QIamp viral RNA extraction kit” (Qiagen) and eluted in 60 µl elution buffer according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... A single colony was picked with an inoculation loop and DNA extraction was performed on the QIAsymphony using the DSP Virus/Pathogen Mini Kit (Qiagen). Library preparation performed using Nextera XT (Illumina Inc. ...
-
bioRxiv - Microbiology 2024Quote: 200µL of lung of infectious cell supernatant (virus stock and HAE) was inactivated with an equal volume of VXL lysis buffer (Qiagen) and viral RNA was extracted using an EZ1 Advanced XL robot with the EZ1 mini virus 2.0 kit (both from Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... reverse transcription quantitative PCR (RT-qPCR) assays were performed with the QuantiTect Virus + ROX Vial Kit (Qiagen, Toronto, ON, Canada) in a LightCycler® 480 system (Roche Molecular System) ...
-
bioRxiv - Biophysics 2019Quote: ... proteins were purified by batch Ni-NTA bead purification (1 mL slurry/1L culture; Qiagen) and further purified by a Superdex 200 16/60 column (GE Healthcare ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA for ANXA2 (Human, Qiagen, Hs_ANXA2_8, SI02632385) or siRNA for Anxa2 (Mouse ...
-
bioRxiv - Biochemistry 2019Quote: ... Bound STAT3 proteins were then labeled with Alexa488-conjugated anti-6 × His antibodies (1 hr incubation, 1:20 dilution, Qiagen 35310). The array was washed and scanned using a GenePix 4400A scanner (Molecular Devices ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Genetics 2021Quote: ... followed by protein precipitation with the Protein Precipitation Solution (Qiagen) for 10 min at -20 °C ...
-
bioRxiv - Immunology 2021Quote: Heat-inactivated human serum was diluted 1:10 in phosphate buffered saline (PBS) and applied to a gravity polypropylene flow column (Qiagen) containing 1 mL of Protein G-sepharose resin (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... human THP-1 macrophages (MACs) and acutely isolated mouse microglia was extracted using the RNeasy Plus Mini kit (Qiagen, 74136) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... splenic B cells were collected for genomic DNA isolation using the DNeasy kit (Qiagen). Sμ–Sγ3 regions were amplified using nested PCR with details and primers as previously described (63) ...
-
bioRxiv - Microbiology 2020Quote: DNA extraction was performed using the PureGene® Yeast/Bact kit B (Qiagen, Germany) following the manufacturer’s instructions for extraction of DNA from Gram-negative bacteria and eluted in molecular grade water.
-
bioRxiv - Immunology 2022Quote: Total mRNA was isolated from primary B lymphocytes using a RNeasy Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... Total RNA was extracted from B cells using RNeasy Mini Kit (Qiagen, Valencia, CA). 100ng RNA was reverse transcribed using SuperScript IV VILO Master Mix (Thermofisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... or total IgDlo memory B cells were bulk sorted into Buffer RLT Plus (Qiagen) supplemented with 143 mM β- mercaptoethanol (Sigma-Aldrich ...