Labshake search
Citations for Qiagen :
101 - 150 of 2656 citations for Human Immunodeficiency Virus Gag Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from 100 μl of the virus stock using RNeasy kit (Qiagen) and analyzed by RT-qPCR ...
-
bioRxiv - Molecular Biology 2022Quote: ... rAAV genomes were extracted and purified using a QIAamp MinElute Virus Spin kit (Qiagen) and titered by qPCR with serial dilutions of a plasmid standard ...
-
bioRxiv - Genomics 2022Quote: ... DNA was then extracted immediately with QIAamp UltraSens Virus Kit (QIAGEN, Cat. No. 53706). The manufacturer’s instructions were followed with the first six steps replaced by combining 140 μL of sample with 5.6 μL carrier RNA and vortexing briefly ...
-
bioRxiv - Biophysics 2022Quote: ... The YB-1 (1-180) protein fragment was purified following the manufacturer’s recommendations (Qiagen). Briefly ...
-
bioRxiv - Genomics 2020Quote: ... and GeneRead Adapter I set B (Qiagen, cat # 180986) according to Qiagen protocol with one exception ...
-
The G2-phase enriched lncRNA SNHG26 is necessary for proper cell cycle progression and proliferationbioRxiv - Molecular Biology 2021Quote: ... and Negative control B Antisense LNA GapmeR (Qiagen, LG00000001) were used as controls for siRNAs and ASOs ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA from these samples was obtained with the QIAamp Mini Elute Virus Spin Kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 2 μl sucrose purified virus using the RNeasy mini kit (QIAgen). The RNA was then treated with TURBO DNase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Total RNA was extracted from each sample using QIAgen DSP virus/pathogen Midi kits (QIAGEN) on a QIASymphonyXP laboratory automation instrument platform ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from 200 μL of specimen using the EZ1 DSP Virus kit (Qiagen) on the EZ1 Advanced XL instrument (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: Tissue homogenates for virus titration were generated using the Tissue Lyzer II (Qiagen, Gaithersburg, MD). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted using QIAsymphony DSP Virus/Pathogen Mini Kit on the QIAsymphony instrument (Qiagen). qRT-PCR was then performed using AgPath RT-PCR (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... viral RNA was extracted from virus stocks using the Qiagen Viral RNA Mini Kit (Qiagen) and was used as a template for multi-segment RT PCR as described previously (31) ...
-
bioRxiv - Genomics 2022Quote: ... Viral nucleic acids were then isolated using QIAamp MinElute Virus Spin Kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions with some modifications described (Cosentino et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Samples for analysis of virus attachment were directly collected by incubating in RLT buffer (Qiagen) for 10 min at room temperature ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and nucleic acid was extracted using EZ1 Advanced XL extraction with a Virus Card (QIAGEN). Six of the 20 FACS populations did not generate sufficient DNA and were not subsequently sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... DNA extraction was performed on the QIAsymphony using the DSP Virus/Pathogen Mini Kit (Qiagen). Library preparation performed using Nextera XT (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: Viral genomic RNA was isolated from concentrated virus stocks with viral RNA isolation kit (Qiagen). RNA was treated with Turbo DNase and inactivation beads (Ambion) ...
-
bioRxiv - Microbiology 2024Quote: ... or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0, Qiagen, Toronto, ON, Canada). Then ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2020Quote: ... or remaining mosquito bodies were collected separately in a 2ml Eppendorf Safe Lock tube with 250μl DMEM (2% FBS, 1% Sodium Pyruvate) with 25 mg/ml Amphotericin B and a stainless steel bead (Qiagen, Hilden, Germany). Samples were stored at −80°C.
-
bioRxiv - Microbiology 2020Quote: ... Viral DNA and RNA were extracted with the QIAamp MiniElute Virus Spin Kit (QIAGEN, Chatsworth, CA) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Real-time one-step reverse transcription quantitative PCR was performed with the QuantiTect Virus Kit (Qiagen, Foster City ...
-
bioRxiv - Bioengineering 2022Quote: RNA was extracted from supernatant culture media using the QIAamp 96 Virus QIAcube HT Kit (Qiagen). E-gene expression was determined using the SensiFAST Probe No-Rox One Step Kit (Bioline ...
-
bioRxiv - Microbiology 2020Quote: ... viral RNA was extracted from apical washes using the QIAamp 96 Virus QIAcube HT Kit (QIAGEN). The SARS-CoV-2 genome was amplified using a highly multiplexed tiling PCR reaction based on the ARTIC protocol (https://www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w ...
-
bioRxiv - Microbiology 2020Quote: ... virus medium was aspirated and cells were harvested using 400 µL of RNAprotect Cell Reagent (Qiagen). RNA was extracted using the Qiagen RNAeasy Mini kit ...
-
bioRxiv - Microbiology 2022Quote: ... The RNA of rescued virus strains was extracted with QIAmp DSP viral RNA mini kit (Qiagen), reverse transcribed and amplified with OneTaq one-step RT-PCR kit (NEB ...
-
Bat influenza vectored NS1-truncated live vaccine protects pigs against heterologous virus challengebioRxiv - Microbiology 2020Quote: ... RNAs were extracted from each amplified single virus using the QIAamp Viral RNA Mini Kit (Qiagen). Each gene segment was synthesized by gene specific primers (primers available upon request ...
-
bioRxiv - Microbiology 2020Quote: ... using a QIAamp Mini Elute Virus spin kit for the viral RNA/DNA extraction (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a QIAamp Mini Elute Virus spin kit for the viral RNA/DNA extraction (QIAGEN, Germany) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Qiasymphony automated platform was used to isolate total cellular RNA (DSP virus/pathogen mini kit (Qiagen). RNA was further processed in an in-house assay using primers of previously validated assays (44 ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from the virus sample with a QIAamp Viral RNA mini kit (QIAGEN). SARS-CoV-2 RdRP-2 gene primer probes sequences are as follows ...
-
bioRxiv - Microbiology 2020Quote: DNA was extracted from each sample using the QIAamp MinElute Virus Spin Kit (Qiagen, Hilden, Germany), and a semi-nested PCR assays was used for the detection of viral nucleic acids in each sample ...
-
bioRxiv - Genomics 2021Quote: ... Remaining 140 µL of concentrated virus was processed according to QIAamp Viral RNA Mini kit (QIAGEN) protocol ...
-
bioRxiv - Microbiology 2023Quote: Nucleic acids were extracted from specimens using QIAamp 96 Virus QIAcube HT Kit (Qiagen, Hilden, Germany), QIAamp Viral RNA Mini Kit (Qiagen) ...
-
Enhancing gene transfer to renal tubules and podocytes by context-dependent selection of AAV capsidsbioRxiv - Cell Biology 2023Quote: Total DNA was extracted from tissues using QIAamp MinElute Virus Spin Kit (57704, Qiagen, Venlo, Netherlands) or KingFisher Cell and Tissue DNA kit (97030196 ...
-
bioRxiv - Microbiology 2024Quote: ... following the manufacturer’s protocol for the QIAamp MinElute Virus Spin Kit (Cat. 57704, Qiagen, Hilden, Alemania). The resulting DNA for each sample was quantified with a Qubit fluorometer (Cat ...
-
bioRxiv - Immunology 2021Quote: B cell subsets were sorted directly into RLT buffer (Qiagen) with 1% mercaptoethanol and then snap-frozen in LN2 ...
-
bioRxiv - Microbiology 2020Quote: ... 1A and B and lysed in RLT buffer (Qiagen, Germany) for RNA isolation ...
-
bioRxiv - Immunology 2022Quote: ... B cell subsets were sorted directly into RLT buffer (Qiagen), and RNA isolated immediately ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
bioRxiv - Genomics 2020Quote: The DNA of VLPs was extracted following the manufacture’s protocol for the QIAampMinElute Virus Spin Kit (QIAGEN). The resulting DNAs were quantified (Qubit ...
-
bioRxiv - Microbiology 2021Quote: DNA was extracted from the sucrose-purified virus using the Qiagen DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extracted from mock and virus infected Vero cells using the RNeasy mini kit (Qiagen, Germany). Next ...
-
bioRxiv - Plant Biology 2020Quote: DNA from virus-infected plant tissues was extracted by DNeasy Plant Mini Kit (QIAGEN, Cat. No. 69104), and 500 ng of purified DNA was subjected to bisulfite treatment using EpiTect Plus DNA Bisulfite Kit (QIAGEN ...
-
bioRxiv - Microbiology 2022Quote: The viral RNA of the egg-passaged virus was extracted using QIAamp Viral RNA Mini Kit (Qiagen). The extracted RNA was then reverse transcribed to cDNA using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs) ...