Labshake search
Citations for Qiagen :
501 - 550 of 10000+ citations for Human High Sensitive Interleukin 8 IL8 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The aqueous phase was isolated through centrifugation in MaXtract high density tubes (Qiagen, 50-727-738). DNA was precipitated at −20°C by the addition of 100% ethanol ...
-
bioRxiv - Microbiology 2023Quote: ... temporaria frogs were homogenized and lysed using a Qiagen High-Frequency Tissue Lyser2 (Qiagen, Hilden, Germany) with lysis buffer and stainless-steel lysis beads at 2,000 Hz for 4 min ...
-
bioRxiv - Immunology 2023Quote: ... The peak fractions were passed through Pierce™ High-Capacity Endotoxin Removal Resin (Qiagen, Hilden, Germany) to remove any remaining lipopolysaccharides (LPS) ...
-
bioRxiv - Microbiology 2023Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Immunology 2023Quote: ... Final libraries were validated on the Qiagen QIAxcel DNA High Sensitivity Bioanalyzer (QIAGEN, Germantown, MD, USA)) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 20 ng of cDNA used for qPCR with the human miFinder miRNA Array (Qiagen). The PCR was done with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Biophysics 2019Quote: ... The human full-length GRASP55 was loaded on to the Ni-NTA superflow column (QIAGEN) and then eluted with 300 mM imidazole in lysis buffer ...
-
bioRxiv - Cancer Biology 2019Quote: ... Reads were mapped to the human genome (hg38) using CLC Genomics Workbench (Qiagen, Hilden, Germany) and data was analysed using HOMER (Hypergeometric Optimization of Motif EnRichment ...
-
bioRxiv - Cancer Biology 2020Quote: ... using a Human Cancer Pathway Finder miScript miRNA PCR Array(Cat # MIHS-102ZF, 331221-Qiagen). Expression of miR-181a was validated by q-PCR using primers (cat # MS00008827 ...
-
bioRxiv - Immunology 2022Quote: ... For RT2 Profiler PCR Array Human Interferons and Receptors (Cat# PAHS064ZC-12, Qiagen, Germantown, MD), RNA extraction (RNeasy Pls Mini kit ...
-
bioRxiv - Microbiology 2019Quote: ... The siRNAs were part of a human whole-genome library obtained from Qiagen (Hilden, Germany) deposited at the Max Planck Institute for Infection Biology (Berlin ...
-
bioRxiv - Cell Biology 2022Quote: Two siRNAs targeting human PRMT5 (FlexiTube siRNA Hs_PRMT5_1, cat#SI04216492 and Hs_PRMT5_2, cat# SI04248951, Qiagen) were used for knockdown experiments in HEK 293T cells ...
-
bioRxiv - Neuroscience 2022Quote: ... human PAAS proteome was imported into Ingenuity Pathway Analysis (IPA) software (QIAGEN, 2020 released version)[84] for canonical pathway analysis ...
-
bioRxiv - Immunology 2023Quote: Human nasal swab samples were inactivated with 350 µls RLT buffer (Qiagen, Cat No. 79216) containing 1% β-mercaptoethanol for a minimum of 10 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... The autophagy screening was performed using the RT2 Profiler™ PCR Array Human Autophagy (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2022Quote: At DIV 28-30 iPSC-MG from 8 C9orf72 ALS/FTD patient lines and 4 control lines were pelleted and lysed using QIAshredder (QIAGEN-79654) and RNA was isolated with RNeasy Mini Kit (QIAGEN-74104 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 8) and the supernatant was incubated with 80 μl pre-washed Ni-NTA coated Sepharose beads (Ni-NTA agarose, (Qiagen, Hilden) for 90 mins at 4°C on a rolling incubator ...
-
bioRxiv - Neuroscience 2024Quote: ... Inclusion bodies were solubilized in 8 M guanidine hydrochloride (GdnHCl) and then PrP was captured using Ni-NTA Superflow beads (Qiagen #30410). Bead-bound PrP was refolded on-column using a 4 h gradient from 6 to 0 M GdnHCl and then eluted using a gradient from 0 to 500 mM imidazole ...
-
bioRxiv - Molecular Biology 2022Quote: ... Fastq files with high quality reads (phred score >30) were uploaded to the CLC Genomics Workbench (Qiagen). Reads were aligned to Mus musculus ensembl_v80 genome ...
-
bioRxiv - Immunology 2021Quote: ... Fastq files with high quality reads (phred score >30) were uploaded to the CLC Genomics Workbench (Qiagen) and reads aligned to the mouse reference genome ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were then transferred to pre-pelleted MaXtract High Density phase-lock tubes (129065, Qiagen, Hilden, Germany), centrifuged 1500 x g 5 minutes at 4°C ...
-
bioRxiv - Genomics 2019Quote: The RNA extraction kit (RNeasy Mini Kit, Qiagen) was used for the total RNA isolation ...
-
bioRxiv - Bioengineering 2020Quote: ... An RNA extraction kit (RNeasy extraction Kit, Qiagen) was used to purify RNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Reverse transcription kits (RT2 First Strand Kit; Qiagen) were used for cDNA synthesis ...
-
bioRxiv - Genetics 2022Quote: ... The PCR amplification was carried out in a 10-μl reaction volume containing 8 μl of Taq PCR Master Mix (Qiagen, Hilden, Germany), 10 μM of each primer (1 μl) ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... 600 µl of lysis buffer (TES (0.1 M TRIS, 10 mM EDTA, 2% sodium dodecyl sulphate; pH 8) and Proteinase K (Qiagen, 20 mg/ml) in a 20:1 ratio ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated by standard procedure from 20-30 heads of 8-day-old males collected on ice and lysed in 600 µl QIAzol Reagent (Qiagen, Venlo, Netherlands). 1 μg of total RNA was treated by DNase (DNase I ...
-
bioRxiv - Cell Biology 2020Quote: ... qPCR was performed using miRCURY LNA miRNA Human Panel I according to manufacturer’s instructions (Exiqon/Qiagen). The data was analyzed using GenEX software (MultiD ...
-
bioRxiv - Immunology 2021Quote: Pathway-specific primer mixes (Rat Antibacterial Response, PBR-148Z, and Human Antibacterial Response, PBH-148Z; Qiagen) were used for preamplification and qPCR arrays (Rat Antibacterial Response ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transfected with 40 nM specific human RBM10-siRNA5 or control AllStar siRNA (Qiagen) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: Human cancer stem cells RT2 Profiler PCR arrays were purchased from Qiagen (Cat# PAHS-176ZA-12) and used in combination with a 7900 HT real-time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... while rodent and human samples were eluted in 100 µl of buffer AE (Qiagen, Hilden, Germany). Samples were stored at −20°C before PCR.
-
bioRxiv - Immunology 2020Quote: ... cDNA was added to the Human Toll-like receptor signaling pathway RT2 Profiler PCR array (Qiagen) and run on an iCycler MyiQ (Bio-Rad) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Targets were included if biochemically confirmed using human tissue or non-species methods (sourced from QIAGEN’s curated Ingenuity Knowledge Base ...
-
bioRxiv - Immunology 2020Quote: ... RNA was extracted from purified human T cells using the RNeasy Plus Minikit (Qiagen, Germantown, MD). 0.5 μg Donor B RNA was mixed with 4.5 μg Donor A RNA to create sample C for quantitation experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... and human induced astrocytes (>day 30 of differentiation) were harvested in RLTplus Lysis buffer (Qiagen, 1053393). Total RNA was isolated using the RNeasy micro/mini plus kit (Qiagen ...
-
bioRxiv - Genetics 2024Quote: ... and aligned to a human reference sequence GRCh38/hg38 by using CLC Genomics Workbench v20 (Qiagen). The TPM (transcript per million ...
-
bioRxiv - Microbiology 2019Quote: ... kit (Qiagen). Phylogenetic groups were determined as described in (Clermont ...
-
bioRxiv - Microbiology 2019Quote: ... Kit (QIAGEN) followed with 16S-ITS PCR as previously described (64 ...
-
bioRxiv - Genetics 2020Quote: ... Kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... Kit (Qiagen). Whole-genome sequencing was performed using the Illumina Nextera XT library protocols and sequenced at 2 x 300bp read length on the MiSeq platform (Ramaciotti Centre for Functional Genomics ...
-
bioRxiv - Microbiology 2024Quote: ... Kit (Qiagen) using 5 mL culture of V_227 which was grown in MMT-YE medium (20°C ...
-
Macrophage-specific NF-kappa B activation dynamics can segregate inflammatory bowel disease patientsbioRxiv - Immunology 2019Quote: ... they were lysed in 50μL sterile PBS by high-speed shaking (2 × 2min at 30Hz; TissueLyser II (QIAGEN)) ...
-
bioRxiv - Genomics 2019Quote: High-molecular-weight DNA was extracted from young leaves of ‘Somei-Yoshino’ tree #136 using Genomic Tip (Qiagen) to prepare the SMRTbell library (PacBio ...
-
bioRxiv - Molecular Biology 2021Quote: High flow amylose resin was purchased from New England Biolabs and Ni-NTA agarose was purchased from Qiagen. Adenosine triphosphate (ATP) ...
-
bioRxiv - Genomics 2023Quote: ... The mixture was then transferred to a 2 mL MaXtract High Density tube (Cat#129056, Qiagen, Hilden, Germany) for phase separation ...