Labshake search
Citations for Qiagen :
451 - 500 of 10000+ citations for Human High Sensitive Interleukin 8 IL8 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... using commercially available primers for human FAAH (CpG Island 100530) (EPHS100530-1A, Qiagen). Methylation-sensitive (EPHS115450-1A ...
-
bioRxiv - Zoology 2020Quote: ... Two independent replicates were performed in 8 μl of volume containing 0.5 U of Hot Start Taq polymerase (Qiagen), 0.18 μM of each primer and 0.04 mg of Bovine Serum Albumin Fraction V (Roche) ...
-
bioRxiv - Biochemistry 2020Quote: ... The solubilized membranes were centrifuged in a Sorvall WX ultracentrifuge (~109,000 g; 45 min, F50L-8×39 rotor) and the supernatant was incubated with Ni-NTA resin (Qiagen) for 2 hours ...
-
bioRxiv - Microbiology 2020Quote: ... and 8 M urea [pH 8.0]) and His-tagged Tax proteins were precipitated with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen). After washing in buffer C (100 mM NaH2PO4 ...
-
bioRxiv - Microbiology 2019Quote: ... 700 μL of cold methanol and 140 μL of EDTA 0.1M were added and vigorously mixed (4 x 45 s) in a mini-bead-beater-8 (Biospec Products, Qiagen). By this way ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and 8 were transfected with a pool of cytotoxic siRNAs (“AllStars” wells, positive control, Allstars maximal death control, Qiagen). Briefly ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were visualised using a Qiaexcel using the Qiaexcel DNA High Resolution (Qiagen, Germany) ...
-
bioRxiv - Genomics 2019Quote: ... The solution was extracted with chloroform : isoamylalcohol (24:1) using MaXtractTM High Density Tubes (Qiagen) and precipitated with a 0.7 volume of isopropanol using a sterile glass rod to collect the DNA ...
-
bioRxiv - Genomics 2021Quote: ... The DNA samples were quantified using the Qubit 3.0 and dsDNA high sensitivity dye (Qiagen). Bacterial load was quantified using real-time PCR based on 16S rRNA gene for eubacteria (62 ...
-
bioRxiv - Genomics 2021Quote: ... The DNA samples were quantified using the Qubit 3.0 and dsDNA high sensitivity dye (Qiagen).
-
bioRxiv - Evolutionary Biology 2021Quote: ... We extracted 800ng of high molecular weight DNA (Qiagen Genomic-tip 20/G; Qiagen, Germany) from one black New Vineyard female (see below) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... We extracted 800ng of high molecular weight DNA (Qiagen Genomic-tip 20/G; Qiagen, Germany) from one black New Vineyard female (see below) ...
-
bioRxiv - Cell Biology 2023Quote: ... High speed supernatant was combined with 6 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) and stirred in a beaker for 1-2 hour(s ...
-
bioRxiv - Molecular Biology 2024Quote: ... The upper phase was carefully poured into 15 mL MaXtract high density gel tubes (Qiagen) and 4 mL of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Biophysics 2021Quote: ... Small interfering RNAs (siRNAs) targeting human AKR1C1-4 were synthesized by Qiagen (Valencia, CA). HepG2-RC cells (5×106 cells/well ...
-
bioRxiv - Genomics 2022Quote: ... pallidum and human RNase P gene (RNP) using a Rotor-Gene 6000 instrument (Qiagen) as previously described with modifications (11 ...
-
bioRxiv - Neuroscience 2022Quote: Cultured human T cells after treatment were flash frozen in Buffer RLT (Qiagen, 79216) and kept in −80°C until processing ...
-
bioRxiv - Genomics 2019Quote: Dissociated human islets cells were transfected with scramble siRNA (Cat# 1027284, Qiagen, Toronto, Canada) or siRNA from ThermoFisher Scientific against OGDHL (ID# s31422) ...
-
bioRxiv - Genomics 2021Quote: cDNA was generated from 5μg of Human XpressRef Universal Total RNA (Qiagen cat # 338112) using Superscript III Reverse Transcriptase (Invitrogen cat # 18080093 ...
-
bioRxiv - Microbiology 2021Quote: The RTK RNAi library contained siRNAs targeting 56 human RTK genes (Qiagen, Dusseldorf, Germany), which included four different pairs of siRNAs for each gene ...
-
Dual RNA-seq identifies proteins and pathways modulated during Clostridioides difficile colonisationbioRxiv - Microbiology 2023Quote: Bacterial and human cells were treated with RNAprotect cell or bacterial reagent (Qiagen, Germany) and stored at -80°C for up to 1 week ...
-
bioRxiv - Neuroscience 2023Quote: Transfected iPSC-OPCs and post-mortem human MS samples were lysed in Qiazol (Qiagen), and RNA was isolated using a standard chloroform extraction and ethanol precipitation method ...
-
bioRxiv - Cell Biology 2023Quote: CD14+ human monocytes were transfected with 200 nM siRNA using the HiPerfect system (Qiagen) as described previously ...
-
bioRxiv - Molecular Biology 2020Quote: ... after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Twenty consecutive 10 μm sections were placed on glass slides for subsequent IHC (sections 1-2, 7-8, 13-14, & 19-20) or placed in 600 μl buffer RLT (Qiagen) containing 1% 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Genetics 2021Quote: ... The gDNA pellet was dissolved in 1mL TE pH 8 buffer and incubated with RNase A with a concentration of 100ug/mL (Qiagen) for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: Total RNAs were extracted from 20 heads (or 15 thoraces or 15 abdomens) of 8-day-old flies using the QIAzol Lysis reagent (Qiagen). The Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... cells were lysed in TE buffer (pH=8) supplemented with 1 mg/ml of lysozyme and 10 µl of proteinase K (Qiagen) for 10 minutes at room temperature with a shaking of 500 rpm ...
-
bioRxiv - Neuroscience 2021Quote: A total of 8 frozen brain samples (five controls and three infected with ZIKV) were processed in TissueLyser® (Qiagen) for 30 seconds at 30Hz for cell disruption ...
-
The mitochondrial genome of the red icefish (Channichthys rugosus) casts doubt on its species statusbioRxiv - Zoology 2022Quote: A small piece of muscle tissue (5.8 mg dry weight) was dried in a vacuum centrifuge and immersed in lysis buffer (260 μL ATL buffer (Qiagen) and 40 μL Proteinase K [20 mg/mL]) ...
-
bioRxiv - Microbiology 2022Quote: For RNAseq the pellets were resuspended in 150 µL 10 mM Tris-HCl pH 8 and mixed with 700 µL of ice cold RLT+BME (RLT buffer (Qiagen) supplemented with 1% β-mercaptoethanol ...
-
bioRxiv - Biochemistry 2020Quote: ... resuspended in buffer A supplemented with 8 M guanidine hydrochloride (= buffer B) and loaded onto an Ni-NTA agarose column (QIAGEN) pre-equilibrated in the same buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... The frozen brain tissue blocks of WRM and BF were boiled for 8 min and homogenized in 5% acetic acid using a TissueLyser LT (Qiagen) for 6 min at 50 Hz ...
-
bioRxiv - Neuroscience 2021Quote: Fluorophore TYE665 labeled locked nuclear acid (LNA) (C4G2)6 and (CCG)8 probes (Supplemental table 2) were synthesized by Qiagen. The FISH protocol was adapted from (DeJesus-Hernandez et al ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA for PIWIL3 5′ RACE was extracted from the ovaries of 8-week-old golden hamsters using ISOGEN (Nippon Gene) and RNeasy (Qiagen). 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio ...
-
bioRxiv - Cell Biology 2020Quote: The validated Alx1DN (N-terminal portion of protein product containing homeodomain and nuclear localization domains) clones in pCS2+8 were purified via miniprep (Qiagen) alongside a control (C-terminal portion containing transactivation domain) ...
-
bioRxiv - Genetics 2019Quote: ... in each well of 8-stripped PCR tubes by shaking with a zirconia bead (2 mm in diameter, Nikkato, Japan) in TissuLyser II (Qiagen) for 30 s at 30 Hz ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA was harvested following an 8 hour DMSO or 10 nM E2 induction with buffer RLT plus (Qiagen, 1053393) supplemented with 1% beta-mercaptoethanol (Sigma Aldrich ...
-
bioRxiv - Genetics 2022Quote: ... 8 cm of leaf tissue was harvested on ice and then lyophilized using a TissueLyser II (Qiagen, Valencia, CA, USA). Genomic DNA was extracted using a Qiagen DNeasy Plant Mini Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... pH was adjusted to 8 after resuspension to allow the binding of 6x His-tagged toxins to Ni-NTA agarose resin (reference: 30210; Qiagen). Resulting samples were passed through chromatography columns containing the Ni-NTA agarose resin and were eluted with denaturing buffer containing increasing concentrations of Imidazole (10 mM ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated as previously described.8 The cDNA and purified viral DNA were used for quantitative PCR (qPCR) using QuantiTect probe PCR master mix (Qiagen) and optimized concentrations of forward primer (TGTGTGGGAGACCATCAAGC) ...
-
bioRxiv - Genomics 2023Quote: ... After ligation nuclei were pelleted and resuspended in cold PBS with DAPI to a final concentration of 300nM and GFP+ cells were FAC-sorted into a 96 well plate with 2ul lysis buffer (20mM Tris pH 8, 20mM NaCl, 0.15% Triton X-100, 25mM DTT, 1mM EDTA, 500nM Carrier ssDNA, and 15ug/mL Qiagen Protease) and lysed for 1 hour at 50°C and inactivated 15 minutes at 70°C ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Biochemistry 2023Quote: ... SUMO protease was added at a final concentration 1/10 and the mixture was dialyzed overnight at 4 °C against the buffer DB6 (50 mM Tris-HCl pH 8, 150 mM NaCl, 10 mM imidazole) and applied on a NiNTA column (Qiagen) equilibrated in the DB6 buffer ...
-
bioRxiv - Developmental Biology 2019Quote: ... low RFP and high RFP populations were sorted into 350 μl of RLT lysis buffer (QIAGEN) with 2 μl of β-mercaptoethanol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2022Quote: ... Unbound biotin was removed by performing a chloroform:isoamyl alcohol extraction using MaXtract High Density tubes (Qiagen). RNA was isopropanol precipitated and resuspended in water ...
-
bioRxiv - Microbiology 2023Quote: High-quality DNA from the antagonistic gut strains was extracted using QIAamp DNA minikit (Qiagen, Germany) following the manufacturer’s instructions ...