Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for Human Eukaryotic Translation Initiation Factor 4E Binding Protein 1 EIF4EBP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The resulting supernatant was subject to binding with Ni-NTA agarose resin (Qiagen) for 30 min at 4 °C with gentle rotation and loaded into the glass chromatography columns (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA from human and mouse kidney samples was harvested using the RNeasy Mini Kit (Qiagen). Total RNA isolation from cultured cells was extracted using Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA from human cancer cells was extracted 48h post transfection using the RNeasy Kit from Qiagen according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: Total RNA was isolated from murine and human monocytes with the RNeasy Plus Micro Kit (Qiagen), and then 200 ng of RNA was reverse transcribed using the iScript RT Supermix (Bio-Rad) ...
-
bioRxiv - Genomics 2022Quote: ... cfDNA was then extracted from human blood plasma using the QIAmp Circulating Nucleic Acids kit (Qiagen), eluted in 60-μl elution buffer (10 mM Tris-Cl ...
-
bioRxiv - Immunology 2020Quote: Total RNA was extracted from mouse or human whole blood using RNA blood mini kit (Qiagen). Isolated RNA was converted to complementary DNA (cDNA ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from cultured human and mouse cells using an RNeasy Mini Kit (Qiagen) and included an on-column DNase treatment to eliminate contaminating genomic DNA ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Microbiology 2021Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using RNeasy Mini Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... mouse organ lysates and human primary cell supernatant samples were prepared in RNeasy Mini Kit (Qiagen) lysis buffer RLT (400μl) ...
-
bioRxiv - Cancer Biology 2020Quote: ... human FLMs and adjacent normal tissue was performed using the AllPrep DNA/RNA Mini Kit (Qiagen). Whole exome sequencing was performed by Novogene using their standard protocols ...
-
bioRxiv - Pathology 2022Quote: ... Total RNA of mouse and human intestinal tissue was isolated using the RNeasy Mini Kit (Qiagen) and total RNA of mouse mesenteric fat was isolated using the RNeasy Lipid Tissue Mini Kit (Qiagen) ...
-
bioRxiv - Physiology 2023Quote: ... and grown to confluency and transfected with human Leptin constructs using Effectene kit (Cat# 301427, QIAGEN).
-
bioRxiv - Cell Biology 2024Quote: Total RNA was isolated from human primary immune cells using the RNeasy Plus Micro Kit (Qiagen). RNA integrity number (RIN ...
-
bioRxiv - Cancer Biology 2023Quote: gDNA was isolated from human sarcoma models and controls using the QIAamp DNA Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
bioRxiv - Cancer Biology 2023Quote: Total RNA was isolated from human sarcoma models and controls using the RNeasy Mini Kit (Qiagen). Library preparation was performed by the Functional Genomics Laboratory (FGL) ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... RNA and protein were extracted 6 days post-transduction using the AllPrep RNA/Protein kit (Cat: 80204, Qiagen, Germantown, MD USA). RNA was converted to cDNA using SuperScript IV cDNA Synthesis Kit (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: A ready-to-transduce transcription factor-responsive lentiviral reporter system (CCS-1022L, QIAGEN) was used to generate a stable cell line ...
-
bioRxiv - Genomics 2019Quote: ... RNA attached to purified protein complexes was isolated with the miRNeasy kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: DNA was extracted using AllPrep DNA/RNA/Protein Mini Kit (Qiagen, Hilden, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Whole DNA and proteins were extracted by the ALLprep Kit (Qiagen, Hilden, Germany), following manufacturer instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... EV and protein fractions using miRNeasy serum/plasma kit (Qiagen 1071073 Lot#160020206) after adding 1.0×10^6 copies/µL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035) ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was isolated using the SampleIN Direct PCR Kit (highQu) or the AllPrep DNA/RNA/Protein Mini Kit (Qiagen), and amplified with ALLin HS Red Taq Mastermix (highQu ...
-
bioRxiv - Bioengineering 2021Quote: Genomic DNA from human primary CD4+/CD8+ T cells was isolated using the Gentra Puregene Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA (gDNA) from human blood cells was isolated using the QIAamp Blood kit (QIAGEN, Hilden, Germany). To isolate gDNA from different mouse tissues we made use of the blackPREP Rodent Tail DNA Kit (Analytik Jena ...
-
bioRxiv - Cancer Biology 2020Quote: Total genomic DNAs (containing human and viral genomes) were isolated using AllPrep DNA/RNA Mini Kit (Qiagen) from the NPC biopsy ...
-
bioRxiv - Cancer Biology 2020Quote: DNA from human and murine PC cells were isolated using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2019Quote: ... Genomic human DNA was isolated from whole blood using QIAamp DNA Blood Mini Kit from Qiagen (51106) and phosphodiester DNA from TIB Molbiol ...
-
bioRxiv - Paleontology 2019Quote: Human 2 and 3: DNA was extracted from bones using QIAamp® DNA Investigator kit (56504, Qiagen). Bones were thoroughly washed (X5 ...
-
bioRxiv - Genetics 2019Quote: RNA was extracted from PCYT1A-wild-type human fibroblasts using the RNeasy Mini Kit (Qiagen, Cat#74104), reverse-transcribed according to the manufacturer’s protocol (SuperScriptIII One-Step RT-PCR system with Platinum Taq DNA Polymerase;Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: Total RNA of human macrophages was isolated according to manufacturer’s instructions using the RNeasy extraction kit (Qiagen). mRNA was extracted using the Next Poly(A ...
-
bioRxiv - Cell Biology 2023Quote: Uninfected or infected primary human macrophages were subjected to RNA extraction using the RNeasy extraction kit (Qiagen). Two µg of RNA each was reverse transcribed with the iScript cDNA Synthesis Kit (Bio-Rad) ...
-
bioRxiv - Immunology 2022Quote: Genomic DNA was purified from human peripheral blood mononuclear cells (PBMCs) using QIAamp kits (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA was extracted from human tissue and cells using the miRNeasy Mini kit (Qiagen, Hilden, Germany) or TRIzol reagent (Thermo Fisher Scientific).
-
bioRxiv - Genetics 2024Quote: The RNA quality of human kidney FFPE sample was checked by RNeasy FFPE kit (Qiagen-Cat #73504) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: RNA from 1205Lu cells and immortalized human melanocytes were isolated and purified using RNeasy Micro Kit (Qiagen) according to manufacturer’s instruction and concentration was quantified using a NanoDrop Spectrophotometer (ThermoScientific) ...
-
bioRxiv - Genomics 2024Quote: ... the effect of human rRNA removal was also assessed using a QIAseq FastSelect rRNA removal kit (Qiagen). The rRNA removal reaction was performed after RNA thermal denaturation at 95℃ 5 min according to the instructions.
-
bioRxiv - Systems Biology 2020Quote: ... RNA and protein fractions using silica-membrane spin columns from the AllPrep DNA/RNA/Protein kit (cat# 80004, Qiagen, Chatsworth, CA, USA). PBMCs were processed in a randomized order ...
-
bioRxiv - Neuroscience 2023Quote: PFC and HPC RNA and protein were extracted following the instructions of the Allprep RNA/protein kit (cataloge no. 80404; Qiagen, Hilden, Germany). RNA was measured by nanodrop ...
-
bioRxiv - Cell Biology 2022Quote: ... His-EHD1 was purified by binding with Ni2+-NTA His-bind slurry (Qiagen, Germany) and eluting with imidazole as described previously (65) ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.01M Tris-Cl (pH 8.0) and passed through a Ni-NTA binding column (Qiagen). The loaded column was washed with 8M urea ...
-
bioRxiv - Biochemistry 2022Quote: ... The detection of binding was carried out by the RGS His6 HRP conjugate (QIAGEN) that detects the RGS His6 motif present in the affitins N-terminal ...
-
bioRxiv - Developmental Biology 2020Quote: The following siRNAs were used for microinjection: human PLCB1 siRNA #1 (CACACTACCAAGTATAATGAA) (Qiagen, Hs_PLCB1_4, SI00115521); PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA ...
-
bioRxiv - Genetics 2022Quote: ... human SETD2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CRY2 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Genetics 2022Quote: ... human CPSF6 siRNA (Qiagen # 1027416 ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... coli BL21 (DE3) and expression of the His-tagged Cas proteins was performed following the instruction of the protein purification kit (Qiagen, Valencia, CA, USA). Single colonies of transformed cells were cultivated overnight ...