Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Glutathione Fluorescent Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... Fluorescent protein was bound to Ni-NTA Superflow columns (Qiagen, Hilden, Germany) equilibrated with 50 mM NaH2PO4 ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... DNA extractions were performed using a DNeasy PowerSoil 96-well plate DNA extraction kit (Qiagen, Hilden, Germany). The standard protocol was used with the following two exceptions ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... colonies were scraped off plates and library plasmids purified using a Qiagen HiSpeed Maxi kit (Qiagen, 12662). Plasmids were eluted in Qiagen Buffer TE ...
-
bioRxiv - Immunology 2023Quote: ... A second round of PCR was performed to generate uniquely barcoded sequencing libraries using the barcode primer plate included in the kit (17μL of working mix which include 12.5μL QIAGEN 2x Multiplex PCR master mix ...
-
bioRxiv - Bioengineering 2023Quote: ... gDNA was purified from cells in 6-well plates using the DNeasy blood and tissue kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: Fibroblasts were grown to confluency in 6-well plates and total RNA extracted using RNeasy Kit (Qiagen). Poly(A)-tailed RNA enrichment and library construction was performed using KAPA stranded mRNA-Seq Kit with KAPA mRNA capture beads (KAPABiosystems) ...
-
bioRxiv - Physiology 2019Quote: ... DNA was extracted from 5 µL of RBCs using the Gentra Puregene Tissue Kit (Qiagen) and kept frozen at −80°C until analysis ...
-
bioRxiv - Neuroscience 2020Quote: ... Powdered tissue (∼5 mg) was dissolved in lysis buffer provided by RNeasy micro kit (Qiagen), supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... BEAS-2B and MRC-5 (2×106 cells/well) using the RNeasy Mini Kit (Qiagen) with DNase I treatment to eliminate DNA contaminants as previously described18 ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from 5 × 106 cells using Qiagen DNeasy Blood & Tissue Kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Biophysics 2022Quote: ... Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen, Germany). Both inserts and vector were eluted and stored in 10 mM Tris-Cl ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from 5 million cells using RNeasy Plus Universal Kits (Qiagen, #73404) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: Cellular RNA of 2-5×105 cells was extracted using the RNeasy Mini Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and RNA purified from 5-dpf embryos with the miRNeasy Mini Kit (Qiagen, catalog #: 217004). Using this cDNA library ...
-
bioRxiv - Microbiology 2021Quote: Confluent 6-well plates of BAC16-iSLK.RTA cells were lysed using a DNeasy Blood and Tissue Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... DNA was isolated from Cac-P4.5 cells (originating from the PtP4.5 selection plate) using the MagAttract HMW DNA Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... Worms were washed from each plates and genomic DNA was extracted using Qiagen DNeasy Blood & Tissue Kit (Qiagen) and quantified by Qubit (Invitrogen) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted from cells grown in 6-well plates using RNeasy Mini Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: CYP124 was crystallized using a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cells were collected again using filter plates and subjected to DNeasy 96 Blood and Tissue Kit (Qiagen 69581) (yielding 4-15μg per strain).
-
bioRxiv - Synthetic Biology 2023Quote: Genomic DNA was isolated from Streptomyces plates or liquid cultures using the DNeasy PowerLyzer PowerSoil Kit (Qiagen, Germany). The bead beating was performed using a TissueLyser LT (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: RNA was extracted from individual wells of 24-well culture plates using a RNeasy Plus Mini Kit (Qiagen) per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA was isolated from 5-week-old Arabidopsis leaves with RNeasy Plant Mini Kit (74904; Qiagen) and used for subsequent RT-qPCR analysis ...
-
bioRxiv - Microbiology 2021Quote: Reverse transcription was performed on 5 μl of RNA suspension using QuantiTect Reverse Transcription kit (Qiagen) with either the qiagen RT primer mix or the SgleadSARSCoV2-F primer (for negative strand viral transcripts ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was isolated from adult (5-week-old) plants using an RNeasy plant kit (Qiagen), treated with a TURBO DNA-free kit (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: Total RNA was prepared from 5×106-1×107 cells using the RNeasy MIDI Kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... AAVS1 +161 bp Reverse 5’ GAGGTTCTGGCAAGGAGAGA) and purified using the PCR clean up kit (Qiagen, MD). Amplicons were sequenced by MiSeq (Illumina ...
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted from 5×106 human PBMCs from Cohort II using AllPrep RNEasy kits (Qiagen) and the small RNA-containing column flow-through collected ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 male C57Bl/6 mice-derived pial tissue was extracted using RNeasy Micro Kit (Qiagen, #74034). After RiboGreen quantification and quality control by Agilent BioAnalyzer ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Genomics 2020Quote: ... before aliquoting into 5 tubes and proceeding with the Qiagen DNeasy Plant Mini Kit (Qiagen; 69104) protocol ...
-
bioRxiv - Biophysics 2022Quote: ... to dephosphorylate 5’ ends.Digested inserts were gel extracted using the QiaQuick gel extraction kit (Qiagen, Germany). Digested and 5’ dephosphorylated vector was purified using the QiaQuick PCR Cleanup kit (Qiagen ...
-
bioRxiv - Developmental Biology 2022Quote: ... total RNA from 5 embryos was extracted using the RNeasy microRNA isolation kit (Qiagen, Valencia, CA), and the RNA samples were digested on-column with RNase-free DNase I to eliminate genomic DNA ...
-
bioRxiv - Genomics 2022Quote: We extracted RNA from 5 × 105 cells using the QIAGEN RNeasy Mini kit (Qiagen, cat # 74014) with DNase I treatment (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of each reaction mixture was used for amplification with the REPLI-g kit (Qiagen) at 16 °C overnight and cleaned with the DNA Clean & Concentrator kit to yield samples for sequencing ...
-
bioRxiv - Microbiology 2024Quote: ... DNA was prepared from approximately 5×106 cells using the DNeasy-96 kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... USA) and detection reagent SYBR Green mix (QIAGEN, Valencia, CA, USA). Gene-specific PCR products were subjected to melting curve analysis and quantified by the 2-ΔΔCt method whereas GAPDH mRNA was determined as the internal control ...
-
bioRxiv - Immunology 2020Quote: Ni-NTA plates (Qiagen) were loaded with 2 μg/mL of SARS-CoV-2 S protein in TBS for 2 h at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 12-273 BM cells at 80% confluence in 6 well plates using the RNeasy Mini Kit (Qiagen 74104). 600 ng of RNA was subjected to DNase I treatment and reverse transcription ...
-
bioRxiv - Genomics 2021Quote: ... in a 15 ul reaction volume in 96-well plates or with the Repli-g Single Cell kit (Qiagen) in a 10 ul reaction volume in 384-well plates ...
-
bioRxiv - Biochemistry 2020Quote: CYP124–SQ109 was crystallized by a sitting drop approach in 96-well crystallization plates with commercially available kits (Qiagen) at 20 °C with 1:1 protein/mother liquor ratio with the ligand concentration of 100 μM ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 ug of RNA was reverse transcribed (Applied Biosystem) ...
-
bioRxiv - Cell Biology 2022Quote: Cells were seeded at 800,000 in 60 mm plates and 24 h later RNA was isolated (Qiagen RNeasy Kit). 1 μg of RNA was reverse transcribed (Applied Biosystems™ High-Capacity cDNA Reverse Transcription Kit) ...
-
bioRxiv - Cancer Biology 2022Quote: Total RNA was isolated from cells in 96-well plates using the Qiagen FastLane Cell Probe Kit (QIAGEN, 216413), according to the manufacturer’s instructions to a final volume of 40 μL per well ...
-
bioRxiv - Cancer Biology 2019Quote: FTE cells were harvested from 6 cm plates and RNA was isolated using miRNAeasy micro kit (Qiagen, Hilden, Germany). Quantity and quality of total RNA was analyzed using Nanodrop (Thermo Scientific) ...