Labshake search
Citations for Qiagen :
101 - 150 of 10000+ citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2023Quote: Small cfRNAs were extracted from ~1 mL of plasma using the miRNeasy Serum/Plasma Kit (Qiagen). 1ul ExiSEQ NGS Spike-in (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: ... was purified from curd stomach milk collected from P7 offspring that were exposed to mCHD (n=4) or mHFD (n=4) using a combination of QIAzol and miRNeasy Mini Kit (217004; Qiagen, Toronto, ON, CA) as described previously (Izumi et al. ...
-
bioRxiv - Bioengineering 2021Quote: DNA contents in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Physiology 2023Quote: DNA content in native/control kidneys (n = 4) and decellularized kidneys (n = 4) were measured using a Qiagen DNeasy Kit (Qiagen, Valencia, CA, USA). The tissues were initially minced and stored overnight at −80°C ...
-
bioRxiv - Genomics 2023Quote: ... 50 nuclei were sorted into each well of 4 twin.tec™ 96 Well LoBind PCR Plates that had 5 uL of EB buffer (Qiagen, 19086), 0.5 uL of 5 x mRNA Second Strand Synthesis buffer (New England Biolabs ...
-
bioRxiv - Epidemiology 2020Quote: Total RNA was extracted from tissue and serum samples using two commercial kits according to the manufacturer’s instructions: QIAamp® RNA Blood for tissues and QIAamp® Viral RNA Kit for serum (Qiagen Inc., Germany). Viral RNA was detected using two previously published RT-qPCR techniques (16,17).
-
bioRxiv - Evolutionary Biology 2022Quote: ... at 4°C until DNA preparation using the DNeasy Blood and Tissue Kit (Qiagen) according to the manufacture’s recommendation ...
-
bioRxiv - Microbiology 2022Quote: ... the Qiagen MagAttract PowerSoil DNA Isolation Kit (Cat#: 27000-4-KF; Qiagen, Carlsbad, CA), against five other extraction kits ...
-
bioRxiv - Microbiology 2019Quote: DNA isolation was performed using the MagAttract PowerSoil DNA Kit (Qiagen, # 27100-4-EP) on Eppendorf epMotion 5075 liquid handlers following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... and purified with the MiniElute PCR purification kit (QIAGEN, Cat. No. / ID: 28006×4). The purified genomic DNA fragments were end-repaired and had an A-tail added to the 3’ end ...
-
bioRxiv - Cancer Biology 2023Quote: ... washed and RNA was extracted from 4×106 cells using the RNeasy kit (Qiagen) (performed in triplicate) ...
-
bioRxiv - Biophysics 2023Quote: ... for 4 h at 37 °C and purified with RNeasy Mini Kit (Qiagen; #74104). Following the in vitro transcription ...
-
bioRxiv - Genomics 2019Quote: ... Plates grown in parallel were used for genomic DNA extraction (DNeasy Blood & Tissue kit, Qiagen), and RNA extraction (TRIzol ...
-
bioRxiv - Molecular Biology 2020Quote: Total RNA was extracted from each SEC fraction by miRNeasy serum/plasma kit (Qiagen 1071073 Lot#160020206) after adding 1.0 x 10^8 copies/μL of cel-miR-39 exogenous spike-in control (Qiagen 219610 Lot#157036035) ...
-
bioRxiv - Immunology 2021Quote: ... Viral RNA from mice serum was extracted using QIAamp MinElute Virus Spin Kit (Qiagen, catalog no. 57704) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2020Quote: ... all 95 blood and serum samples were first applied to the QIAamp DNA mini kit (Qiagen, USA) for viral DNA extraction and then confirmed the ASFV presence by VDx®ASFV qPCR Kit (Median Diagnostics Inc. ...
-
bioRxiv - Microbiology 2022Quote: Viral RNA isolation from serum or tissue sample were performed using QIAamp Viral RNA Mini Kit (Qiagen) or PureLink RNA Mini Kit ...
-
bioRxiv - Molecular Biology 2024Quote: Total small RNA was extracted from EVs or WS samples using the miRNeasy Serum/Plasma Kit (Qiagen). miRNAs were quantified using Qubit™ microRNA Assay Kits (ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... cfDNA was extracted from approximately 4□ml of plasma (QIAamp Circulating Nucleic Acid kit, Qiagen) and then constructed into sequencing libraries with end repair ...
-
bioRxiv - Physiology 2021Quote: Total RNA was purified from embryos at 4 dpf using an RNeasy micro kit (Qiagen) with DNase I ...
-
bioRxiv - Neuroscience 2022Quote: ... we used 4 columns to purify product following the MinElute PCR Purification Kit manual (Qiagen). DNA from each column was eluate using 25 μL EB buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 4 µg of the total RNA was treated with a GeneRead rRNA Depletion kit (Qiagen) and then with an RNeasy MiniElute kit (Qiagen ...
-
bioRxiv - Plant Biology 2022Quote: Total plants RNA were extracted from 4 weeks plants using the RNeasy kit (Qiagen, Germany) and two micrograms of RNA was reverse-transcribed using SuperScript IVTM Reverse Transcriptase according to the manufacturer’s instructions (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned with the UltraClean 96 PCR Cleanup kit (Qiagen, Cat. #12596-4) and pooled using the same volume for each sample ...
-
bioRxiv - Neuroscience 2023Quote: Total mRNA from 2 to 4 organoids were isolated using the RNeasy mini kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or from whole fecal pellets using a DNeasy PowerSoil HTP 96 kit (Qiagen 12955-4). Library preparation and sequencing was performed at the NGS Competence Center NCCT (Tübingen ...
-
bioRxiv - Genomics 2022Quote: ... The 12 wells from individual plate rows were pooled and cleaned (QIAquick PCR Purification Kit, QIAGEN), and the 30μl elutions resulting from every prep were combined and vortexed thoroughly ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were transfected using Effectene transfection kit for individual dishes or 24 well plates (Qiagen) or Linear PEI (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... Colonies were scraped off the plates and plasmids were extracted with a plasmid maxiprep kit (Qiagen).
-
bioRxiv - Evolutionary Biology 2020Quote: Viral RNA was extracted from the patients’ serum using a QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany). Paired-end sequencing was performed by the University College London Pathogen Genomics Unit ...
-
bioRxiv - Epidemiology 2019Quote: ... all serum samples were extracted with total viral RNA using a QIAamp viral RNA mini kit (Qiagen, Germany). Next ...
-
bioRxiv - Molecular Biology 2019Quote: ... flow-through and the immunoprecipitated product were kept for RNA extraction using the miRNeasy Serum/Plasma Kit (Qiagen). Synthetic spiked-in of 0 ...
-
bioRxiv - Genomics 2021Quote: ... Total RNA was isolated starting from plasma aliquots of 250 μl using miRNeasy Serum/Plasma Advanced Kit (Qiagen) according to manufacturers instructions and eluted into 20 μl of nuclease-free water ...
-
bioRxiv - Molecular Biology 2022Quote: ... cfDNA was extracted from 0.5 ml of plasma/serum using the QIAmp DNA Mini Blood kit (Qiagen, CA), performed according to the ‘‘Blood and body fluid protocol’’ and our own detailed protocol [37] ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 4 mL of culture using the miRNAeasy Mini Kit (Qiagen, Hilden, Germany) and Qiazol lysis reagent ...
-
bioRxiv - Developmental Biology 2022Quote: The total RNA of 3-4 organoids was extracted using the RNeasy Plus Micro Kit (Qiagen), followed by reverse transcription to generate cDNA with GoScript Reverse Transcription Kit (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... 4°C) and total RNA was extracted from the supernatant using the RNeasy Mini Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: Total hippocampus RNA was isolated from 4-month olds rats using RNeasy Lipid Tissue Kit (Qiagen) as per manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µL of 10 mg/mL RNase A (DNeasy Blood &Tissue kit, #69504, Qiagen, Hilden, Germany) was added to each sample and incubated at 37°C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 100mg of roots of 4-day-old seedlings according to the RNeasy Plant Mini Kit (Qiagen). cDNA was synthesized from 1µg of total mRNA using the QuantiNova Reverse Transcription Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from cultures using a DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The 16S gene was amplified using primers 5’AGAGTTTGATCCTGGCTCAG and 5’GACGGGCGGTGWGTRCA ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Microbiology 2023Quote: DNA was extracted from cultures using the DNeasy UltraClean 96 Microbial Kit (Qiagen, Cat. #10196-4). The bacterial 16S rRNA variable region 4 (V4 ...
-
bioRxiv - Immunology 2023Quote: RPMs (4 × 105 cells) were harvested and total RNA was extracted with RNeasy micro kit (QIAGEN). RNA libraries were prepared using TruSeq stranded mRNA Library Prep Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 OD600 of cells were harvested and RNA was extracted using the RNeasy Mini Kit (Qiagen) in conjunction with the RNase-Free DNase Set (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Plant Biology 2020Quote: ... 6 and 48 HAT to ammonium or nitrate amended plates using RNeasy® Plant Mini kit (QIAGEN) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: ... DNA extractions were performed using a DNeasy PowerSoil 96-well plate DNA extraction kit (Qiagen, Hilden, Germany). The standard protocol was used with the following two exceptions ...
-
bioRxiv - Immunology 2022Quote: BMDMs were grown in 6-well plates and RNA was isolated using the RNeasy Mini kit (Qiagen) following the manufacturer’s instructions ...