Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Creatinine Serum Kit 4 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and released in PyroMark Q24 plate (Qiagen) pre-loaded with 0.375 μM of sequencing primer ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... and FdxE−CYP143 (200–250 µM) were crystallized in 96-well plate using a sitting-drop method with commercially available kits from Qiagen (NeXtal Classics II screen) and Molecular Dimensions (Structure screens 1 and 2 ...
-
bioRxiv - Microbiology 2023Quote: ... Colonies were picked onto fresh plates and genomic DNA extraction was carried out using the QIAamp® DNA Mini Kit (QIAGEN; cat. number: 51306) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2019Quote: ... to remove the cell debris and were stored at −80°C for no longer than 4 weeks until isolation of cf DNA with QIAamp DNA Blood Mini Kit (Qiagen GmbH, Hilden, Germany) and measurement of plasma concentrations of cf n-DNA and cf m-DNA with real time quantitative PCR as described previously3 ...
-
bioRxiv - Developmental Biology 2019Quote: The Duke Microbiome Shared Resource (MSR) extracted bacterial DNA from gut and water samples using a MagAttract PowerSoil DNA EP Kit (Qiagen, 27100-4-EP) as described previously (Murdoch et al. ...
-
bioRxiv - Microbiology 2019Quote: Genomic DNA (gDNA) extraction was performed using a custom liquid handling protocol based on the Qiagen MagAttract PowerMicrobiome DNA/RNA Kit (Qiagen 27500-4-EP) adapted for lower volumes ...
-
bioRxiv - Systems Biology 2020Quote: Total RNA was extracted from hypothalamus and hippocampus (n = 4 per dietary group per tissue; total 32 samples) using an All-Prep DNA/RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Sample size was based on previous RNA-Seq studies in which findings were validated using qPCR and gene perturbation experiments [6 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Genomic DNA from 4-8 microdissected 10 μm FFPE sections were extracted using the QIAamp DNA FFPE Tissue kit (Qiagen, cat. no. 56404) according to manufacturer instructions ...
-
Assessment of Human Renal Transporter Based Drug-Drug Interactions Using Proximal Tubule Kidney-ChipbioRxiv - Cell Biology 2022Quote: Total RNA was isolated from cells in the Kidney-Chip (4 individual samples obtained on Day 14) and transwells (4 samples obtained on Day 14) using buffer RLT plus and RNeasy® Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). The tube was initially vortexed to homogenize the solution before incubation at 65 °C for 30 minutes with a short vortex every 5 minutes.
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Microbiology 2021Quote: Total genomic bacterial DNA extraction was performed from frozen fecal samples using the Qiagen DNeasy PowerSoil HTP Kit (Cat. No. 12955-4, Qiagen, Valencia, CA, USA). Adequate DNA yield was confirmed using NanoDrop spectrophotometry ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was extracted from the hippocampus and cortical regions of Ctrl WT and cKO mice (n=4 per group) using the RNeasy kit (Qiagen, Valencia, CA, USA) method (see location of cortical areas 1 and 2 in the Supplementary Figure 1) ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA was extracted from dolphin oral samples and 32 negative (PBS) controls using the DNeasy UltraClean 96 Microbial Kit (Qiagen Cat. #10196-4) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and Human Serum/Plasma miRCURY LNA miRNA PCR array (Qiagen, Catalog Number ...
-
bioRxiv - Cell Biology 2023Quote: ... serum-free medium and HiPerFect Transfection Reagent (Qiagen, Hilden, Germany) were premixed and incubated with cells according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... cDNA was quantified using 96-well PCR array analysis on a PAMM-150ZA plate (Cytokines & Chemokines) and PAMM-016ZA plate (Type I Interferon Response) (both Qiagen). Quantitative real time-PCR (QRT-PCR ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube containing the two phases was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The tube containing the two phases was then fitted in a 96-well storage plate and secured between the top and bottom plates of TissueLyser II (QIAGEN). The components were then mixed for 10 seconds at 15 Hz followed by 7 seconds at 17 Hz ...
-
bioRxiv - Genomics 2020Quote: ... 25 nuclei were sorted into each well of 96-well plates (8-10 plates per experiment) containing 12 µl of nuclear lysis buffer (11 µl of EB buffer (Qiagen) supplemented with 0.5 µl of 100X BSA and 0.5 µl of 1% SDS) ...
-
bioRxiv - Physiology 2022Quote: ... Using the Neuronal ion channel plate (Qiagen, UK), 84 ion channels as well as housekeepers were measured in each sample ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and released into a PyroMark Q24 plate (Qiagen) pre-loaded with 0.3μM of sequencing primer ...
-
bioRxiv - Genetics 2023Quote: ... plates were shaken on a TissueLyser II (Qiagen) at 900 rpm (15 rps ...
-
bioRxiv - Microbiology 2023Quote: ... 3–20 μl of individual PCR products (adjusted on the basis of estimated relative amplicon concentration) were combined into 100 μl subpools and purified using an UltraClean 96 PCR cleanup kit (Qiagen Beverly LLC #12596-4). Despite not producing visible PCR bands ...
-
bioRxiv - Genomics 2022Quote: 4 μL of Vapor-Lock (QIAGEN, 981611) was manually dispensed into each well of a 384-well plate using a 12-channel pipette ...
-
bioRxiv - Molecular Biology 2019Quote: ... with 4 µg RNAseA/ml (Qiagen 158922)] and placing cells on ice for 20 min ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 4 µg of RNaseA (Qiagen 28306) overnight as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’; Qiagen), si-USP36-1 (5’-CAAGAGCGUCUCGGACACCUA-3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 40 min, 4°C) prior to incubation (1 h, 4°C) with 4.0 mL of Ni-NTA agarose (Qiagen) pre-equilibrated in the same buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Extract was cleared by centrifugation at 186,000g for 1 hour at 4 °C and then incubated at 4 °C with NiNTA resin (QIAGEN) for 4 h ...
-
bioRxiv - Microbiology 2020Quote: ... and 20% fetal bovine serum using a TissueLyser (Qiagen, Hidden, Germany). After centrifugation of 12000 rpm for 10 mins ...
-
bioRxiv - Microbiology 2019Quote: ... with two sets of 96-well adapter plates (QIAGEN) containing 2 ml microcentrifuge tubes (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was loaded with a QIAgility Robot (Qiagen) and run on 7500 Fast Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: ... Plates contained 5 µl of TCL lysis buffer (Qiagen) supplemented with 1%β-mercaptoethanol ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease73 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Cell Biology 2023Quote: ... ULK2 (mixture of 4 siRNAs, GS9706), TBC1D14 (mixture of 4 siRNAs, GS57533) and non-targeting (NT, # 5091027310) were purchased from Qiagen.
-
bioRxiv - Biophysics 2022Quote: ... The protein was eluted with 3C protease40 and subsequently incubated at 4°C for 2 h with 4 mL of Strep-tactin Superflow Plus beads (Qiagen) pre-equilibrated with buffer E ...
-
bioRxiv - Immunology 2021Quote: ... Samples were diluted 4:1 (elution buffer (Qiagen) ...
-
bioRxiv - Biochemistry 2020Quote: ... 3-4 mL of Ni-NTA resins (Qiagen) were applied on the gravity column ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase Inhibitor (4 unit/µl) (cat # 1055213, Qiagen), rRNasin Rnase inhibitor (40 U/µl ...