Labshake search
Citations for Qiagen :
101 - 150 of 1473 citations for Calcium calmodulin Dependent 3' 5' Cyclic Nucleotide Phosphodiesterase 1C PDE1C Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μL water and 5 μL 2x QuantiFast® SYBR® Green PCR Master Mix (Qiagen). Technical duplicates of this reaction mix were then analyzed on a Corbett Rotor-Gene 6000 real-time PCR cycler ...
-
bioRxiv - Biochemistry 2020Quote: ... and pJET_Luc_FL_UTR_REV (5’-GCAATGAAAATAAATGTTTTTTATTAGGCAGAATCCAAATGC-3’) primers and was purified with the QIAquick PCR Purification Kit (Qiagen) directly after the PCR reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... A Locked Nucleic Acid (LNA) probe was used to detect centromere regions (5’-TTGGCTACACCATGAAAGCTT-3’; Qiagen). 20 μL of probe mix (250 nM LNA probe ...
-
bioRxiv - Genomics 2021Quote: ... The fragmented and labeled DNA samples were purified from excess nucleotides using “QIAquick PCR Purification Kit” columns (QIAGEN), according to manufacturer’s recommendations.
-
bioRxiv - Cancer Biology 2020Quote: RNA from 18 nucleotides (nt) upwards was extracted from 106 cells homogenized in QIAzol Lysis Reagent (Qiagen, #79306) and using the miRNeasy Mini kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... The presence and nucleotide sequence of resistance genes were manually verified using the QIAGEN CLC genomics workbench 21.0.3 (QIAGEN Digital Insights ...
-
bioRxiv - Microbiology 2021Quote: ... The effect of IscR-C92A on σ70-dependent activity was determined by incubating IscR-C92A with 2 nM supercoiled pPK12778 [purified with the QIAfilter Maxi kit (Qiagen)] ...
-
bioRxiv - Bioengineering 2023Quote: B16.F10 melanoma cells were transduced to express luciferase in an ISRE-dependent manner via the Cignal Lenti Reporter construct (Qiagen) as described previously.46 6-8 week-old C57BL/6 mice (The Jackson Laboratory ...
-
bioRxiv - Neuroscience 2021Quote: ... matching a sequence in intron 22 of the HTT gene (5’-TAATACGTAAGTGTCACAA-3’, custom synthesized by Qiagen) was delivered by intracerebroventricular (ICV ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA was extracted from pools of 3-5 second leaves using the Plant RNAeasy kit (Qiagen) using manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... cells pooled from n = 3 - 5 mice / cohort) was isolated using the RNeasy Plus Mini Kit (Qiagen). Clariom S microarray analysis (Affymetrix ...
-
bioRxiv - Microbiology 2019Quote: ... Samples were neutralized with 0.7 µL of a 7.5 M HCl stock and the remaining cDNA was purified using a nucleotide removal kit (Qiagen). Sequencing reactions were performed according to the method of Sanger ...
-
bioRxiv - Microbiology 2019Quote: ... free acid (pH ∼5.5) was then added and the resulting DNA was purified using a Nucleotide Removal kit as instructed (Qiagen).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA (including RNA from approximately 18 nucleotides or more) was extracted using the miRNeasy kit according to the manufacturer’s instructions (Qiagen). Libraries were prepared using the TruSeq Small RNA Library kit (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... A neighbour-joining tree was built using the Jukes-Cantor nucleotide distance model and 1,000 bootstraps in CLC Sequence Viewer 7 (Qiagen).
-
bioRxiv - Microbiology 2022Quote: ... monocytogenes 10403S reference genome (NC_017544) and single nucleotide polymorphisms (SNPs) with a frequency of at least 90% identified using CLC workbench genomics (Qiagen) and Geneious Prime® v.2021.0.1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Samples were neutralized with 0.7 μl of a 7.5 M HCl stock and the remaining complementary DNA was purified using a nucleotide removal kit (QIAGEN). Sequencing reactions were performed using a commercial kit designed to be used with fluorescent dye-labeled primers (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2021Quote: ... and probe (375 nM, 5’-6FAM-ACACTAGCC/ZEN/ATCCTTACTGCGCTTCG-IABkFQ-3’) with 12.5μL of 2X QuantiFast Probe Mix (QIAGEN), 0.25μL of 2X QuantiFast RT Mix (QIAGEN) ...
-
bioRxiv - Cell Biology 2019Quote: ... and SHARPIN siRNA (5’-GCUAGUAAUUAAAGACACAd(TT)-3’) and the scramble Allstars negative control siRNA were ordered from QIAGEN. Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150 ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2019Quote: ... The products from 3 to 5 PCR reactions were pooled before purifying the DNA on MinElute columns (Qiagen).
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... For experiments with HURP knockdown the custom siRNA with 5’ to 3’ sequence used was AGUUACACCUGGACUCCUUTT (Qiagen, 1027423).
-
bioRxiv - Neuroscience 2023Quote: ... LNA-CTG and the control scrambled LNA-modified sequence (LNA-SCB) 5′-GTGTAACACGTCTATACGCCCA-3′ were obtained from Qiagen as previously described in Rue et al 34
-
bioRxiv - Genomics 2019Quote: ... RNA was removed using NaOH hydrolysis and cDNA was purified using the buffers from the QIAquick Nucleotide Removal Kit and the columns from the MinElute Reaction Cleanup Kit (Qiagen). Finally ...
-
bioRxiv - Biochemistry 2022Quote: Amplification was verified by running the PCR product on a 2% agarose gel and the PCR products pooled and cleaned up with QIAquick Nucleotide Removal Kit (Qiagen). The DNA content was quantified with Quant-iT PicoGreen dsDNA Assay Kit.
-
bioRxiv - Genetics 2021Quote: ... were mixed with 15 µl of each sample and overhangs were quantified by Pyrosequencing using the following dispensation order GTGTGTCACACATGTGTGTG (nucleotides were pipetted in a two-fold dilution) in the PyroMark Q24 (Qiagen). The peak height from dispensation 13 (T ...
-
bioRxiv - Molecular Biology 2023Quote: ... Amplified cDNA was subsequently isolated by separation in a 3% agarose gel and isolation of cDNAs 200 to 600 base pairs in length (corresponding to 100 to 500 nucleotide RNAs plus adaptors) using QIAquick gel extraction kit (Qiagen) according to manufacturer’s recommendation ...
-
bioRxiv - Neuroscience 2021Quote: ... Between 0.1 and 1.0 μg (region dependent) of normalized sample were used for cDNA synthesis using QuantiTect Reverse Transcription Kits (Qiagen, Valencia, CA, USA).
-
bioRxiv - Systems Biology 2022Quote: ... Ten millilitres of culture were pelleted by immediate centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... accordingly to manufacturer’s instructions using non-targeting siRNA (siCtrl; 5’-AATTCTCCGAACGTGTCACGT-3’) and siRNA targeting Cav1 (SI00299635 and SI00299628) from Qiagen, or using pre-miR-NC (negative control ...
-
bioRxiv - Developmental Biology 2019Quote: ... The TSB (5’-ATTATTGCACCCAGTGCC-3’: the miR-92a-3p target site is underlined) was designed and produced by Qiagen, with an additional scrambled TSB to act as a negative control (5’-TAACACGTGTATACGCCCA-3’) ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Bioengineering 2024Quote: Ten millilitres of culture were pelleted by centrifugation (5,000 × g for 3 min at 4°C) and resuspended in 5 mL of RNAlater (76106; Qiagen). Samples were stored at 4°C overnight ...
-
bioRxiv - Cell Biology 2019Quote: ... HEK 293FT cells were transfected using calcium phosphate method and U2OS cells using Effectene Transfection Reagent (Qiagen). To induce primary cilia ...
-
bioRxiv - Cell Biology 2020Quote: Isolated Chromatin was digested with 1% proteinase K for 2 hrs at 60 °C with 300 rpm and was subsequently purified by using QIAquick® Nucleotide Removal Kit (28306, Qiagen) according to the manufactory’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... and E11 (5’-AGGAAAAAGGAAATAAATTA-3’) primers on pDH373 as a template generated a smaller fragment that was cleaned up by QIAGEN MinElute PCR Purification Kit (#28004) ...
-
bioRxiv - Developmental Biology 2021Quote: ... E18.5 RNA was extracted from cortices of 3 genotypic conditional knockouts and 4 controls using the RNeasy Micro Kit (Qiagen). RNA was reverse transcribed to cDNA using the SuperScript™ II Reverse Transcriptase Kit (Invitrogen) ...
-
bioRxiv - Cell Biology 2022Quote: ... LRRCC1-si2 (target sequence: 5’- TTA GAT GAC CAA ATT CTA CAA - 3’) and control siRNA (AllStars Negative Control) were purchased from Qiagen. siRNAs were delivered into cells using Lipofectamine RNAiMAX diluted in OptiMEM medium (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... and template-switching oligo (5′-AAGCAGTGGTATCAACGCAGAGTACrGrG+G-3′, where “r” indicates a ribonucleic acid base and “+” indicates a locked nucleic acid base; Qiagen). cDNA was amplified using KAPA HiFi HotStart ReadyMix kit (Roche #KK2502 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNAs used were: AllStars Negative control siRNA (cat# 1027281) and si-Rab13 #8 (cat# SI02662702; target sequence: 5’-ATGGTCTTTCTTGGTATTAAA-3’) from Qiagen.
-
bioRxiv - Microbiology 2020Quote: ... All samples were then passed 3-5 times through a 26G needle prior to RNA isolation using the RNAeasy mini kit from Qiagen. RNA concentrations were estimated by absorbance measurement at 260 and 280 nm ...
-
bioRxiv - Molecular Biology 2022Quote: Qiagen miRCURY locked nucleic acid DIG (digoxigenin)-labeled probes (sense cATM-DIG: 5’DIG-AGTGGTTAGACAGTGATGTGT-DIG 3’) (Qiagen, Hilden, Germany) were used for ISH ...
-
bioRxiv - Developmental Biology 2019Quote: Total RNA was isolated from approximately 100 EBs (differentiation day 2 and 3) or 25 EBs (differentiation day 4 and 5) using RNeasy Mini kit (Qiagen). 0.5 μg RNA was transcribed to cDNA using QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Pathology 2021Quote: ... DNA was extracted from epidermal tissue (approximately 3 - 5 mm2 per lesion) using a DNAeasy blood and tissue kit (Qiagen). Regressed and CsA group mice were culled at day 133 post-infection ...
-
bioRxiv - Genetics 2021Quote: ... and 99F8 (150 ng pU6-3-99F8-gRNA (DGRC Cat# 1549) and 150 ng pBS-99F8-5’HR-attP>>Act5C::GFP<
3’HR) loci using Effectene Transfection reagent (QIAGEN) as per the manufacturer’s recommendation ... -
bioRxiv - Cell Biology 2021Quote: Formalin-fixed paraffin-embedded tissues were used for in situ hybridization (ISH) employing locked nucleic acid (LNA) probes labelled with digoxigenin (DIG) at both the 5′- and 3’-ends (Qiagen). ISH was performed with probes specific for miR-132-3p (10 nM ...
-
bioRxiv - Developmental Biology 2022Quote: A repair template containing TagRFP-T::AID with homology at the 5’ and 3’ ends to the egl-43 locus was PCR amplified and purified using a PCR purification kit (Qiagen). 3 μl of 10 μM tracRNA (IDT ...
-
bioRxiv - Genomics 2022Quote: ... were annealed (10 μL each 100 μM) to 10 μL 5′-[Phos]-CTGTCTCTTATACACATCT-3’ oligonucleotide (100 μM) within 80 μL EB buffer (Qiagen), incubating 2 min at 95°C and cooled to room temperature (0.1°C/sec) ...
-
bioRxiv - Plant Biology 2022Quote: ... Total RNA was extracted from 3-5 mm ear primordia of the inbred line B73 using RNeasy Mini Kit (Qiagen) with on-column DNase I (Qiagen ...