Labshake search
Citations for Qiagen :
601 - 650 of 964 citations for CTLA 4 Mouse HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Total RNA from 700,000 to 1.25 million RGCs from 4 independent rat litters per developmental stage was isolated using the Qiagen RNAeasy kit from Qiagen, which included a 15 minutes On-column DNAse step ...
-
bioRxiv - Genomics 2021Quote: Strains were grown overnight in 50 ml YPD broth and genomic DNA was extracted from approximately 4×109 cells using a QIAGEN Genomic-tip 100/G kit (10223, QIAGEN) with minor modifications ...
-
bioRxiv - Cancer Biology 2021Quote: ... 250 to 1000 μm lengths of epithelium sections were microdissected from 4 to 6 successive serial sections and DNA extracted using a QIAMP DNA microkit (Qiagen) by digesting overnight and following manufacturer’s instructions ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2021Quote: DNA was extracted from feces pellets using the Qiagen MagAttract PowerMicrobiome DNA/RNA EP kit (QIAGEN, Cat#27500-4-EP). The V4 region of the 16S rRNA-encoding gene was amplified from extracted DNA using the barcoded dual-index primers developed by Kozich et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysates were clarified by centrifugation at 24,000g at 4°C for 20 min and passed through 2 mL of Ni-NTA nickel resin (Qiagen, 30250) pre-equilibrated with wash buffer (20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Developmental Biology 2021Quote: Total RNA was isolated from a pool of 20 mechanically homogenized embryos at 96 hpf for each sample (n=4) using TRItidy G (AppliChem) and 500 ng of cDNA was synthesized using QuantiTect Reverse Transcription Kit (Qiagen) according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... Lysates were clarified by centrifugation at 12,000xg at 4°C and mixed with 200 µL of a slurry of Ni2+-NTA agarose (Qiagen #30210) that had been equilibrated in lysis buffer ...
-
bioRxiv - Genomics 2020Quote: ... and 3-week-old) and leaves (4-, 5-, and 6-week-old plants) was isolated and purified using RNeasy Plant Mini Kit (Qiagen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... and 0.4 mg/mL Proteinase K (55°C for 1 hour) before being purified using the QIAquick PCR purification kit (QIAGEN). qPCR was performed on the Rotor-Gene 3000 (Corbett Life Science ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Immunology 2022Quote: ... Kidneys were mechanically disrupted with metal beads during 3 min at 4°C and DNA was then extracted using QIAmp DNA kit (Qiagen). Leptospiral DNA was specifically targeted using primers and probes designed in the lpxA gene (L ...
-
bioRxiv - Cancer Biology 2022Quote: 3 Type D and 3 Type V SCLC tumor-derived cell lines were treated with either vehicle (EtOH) or 4-OHT for 3 days and RNA was isolated using the RNeasy Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: We euthanized groups of 20 to 30 zebrafish larvae by immersion in ice-cold water (below 4°C) and immediately performed RNA extraction using the RNeasy Mini Kit (Qiagen) and reverse transcription using the High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Passage 0 and 4 organoids were dissociated to single cell suspensions and DNA extracted using the QIAamp DNA Micro kit (Qiagen). The extracted genomic DNA was sheared and the fragments were end repaired ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA of LDOs in EM on day 4 after passage was extracted using the RNeasy Mini kit (QIAGEN, Hilden, Germany). After cDNA synthesis using the QuantiTect Rev ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... PCR products were separated on a 4% agarose gel at 110V for 40 min and proper-sized products extracted using QIAquick gel extraction kit (Qiagen). Following denaturation in undyed loading buffer at 95°C for 3 min ...
-
bioRxiv - Neuroscience 2023Quote: RNA was isolated from hippocampal tissues of 4- and 9-month-old WT and Tau mice using RNeasy Mini kit from Qiagen with DNase digestion ...
-
bioRxiv - Immunology 2022Quote: mRNA was isolated from Boyden chamber migration assay-derived Treg pellets from 5 HD and 4 uRRMS patients using RNeasy micro kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... diluted in fresh culture media or left untreated (n = 4) for 6 h prior to harvesting RNA in RLT buffer (Qiagen) with added β-ME ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting mixture was rotated at 4 °C for 60 min and then poured into a 1 mL polypropylene column (Qiagen). The resin was washed three times with 5 mL lysis/wash buffer and eluted in 0.25 mL fractions with Ni-NTA elution buffer (composition same as lysis/wash buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly sorted cells were pelleted at 500 g for 10 minutes at 4° and then resuspended in RLT Plus buffer (Qiagen). Cells were vortexed and frozen for at least one day at −80° before being thawed on ice and processed for RNA using an RNeasy Mini Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the chromatin incubated at 67 °C for 4 h following a purification step with the QIAquick PCR Purification kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2023Quote: ... beads were discarded and the supernatant containing reconstituted into ND A2AAR was incubated for 4 h with 250 µL of Ni-NTA resin (Qiagen) for separating from empty ND ...
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA was isolated from fecal matter and gastrointestinal sections using the DNeasy HTP 96 PowerSoil Kit (Qiagen, 12955-4). All DNA was recovered in ultrapure water without additives and stored at −20 °C.
-
bioRxiv - Biochemistry 2023Quote: ... the cell lysate was cleared by centrifugation (20L000 rpm, 30 minutes, 4 °C) and purified using Ni+2-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... previously coated with the anti-B55δ antibody (1 hour incubation at 4°C, followed by extensive washes) and Nickel beads (Qiagen) coated with 400 μg of 6XHIS-S67thio-S109A-XeARPP19 ...
-
bioRxiv - Plant Biology 2023Quote: 7-day old in vitro grown plantlets or adult leaves of soil grown 3-4 week-old plants were ground in 2 mL tubes using a Tissue Lyser (Qiagen) twice for 30 sec at 30 Hz before RNA extraction using the RNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Biochemistry 2023Quote: ... Filters were incubated at 55°C for approximately 4 h and the resulting lysates were purified with the DNeasy kit (Qiagen) using a slightly modified protocol49 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Prior to RNA extraction individuals were homogenized in 200 μl homogenization buffer including 4 μl 1-Thioglycerol using a TissueLyser II (Qiagen) with a mixture of five 1 mm zirconia (BioSpec Products ...
-
bioRxiv - Developmental Biology 2023Quote: ... Supernatants were separated from lysates and incubated with affinity beads at 4°C overnight (His beads: Ni-NTA from QIAGEN; GST beads ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was isolated from the hippocampus of P65 females of all four groups (n=4/group) using the RNeasy Midi Kit (Qiagen). RNA samples were submitted to the University of Minnesota Genomics Center for library preparation and sequencing ...
-
bioRxiv - Bioengineering 2023Quote: Genome DNA was extracted from each cell line every 3 – 4 days after transfection or transduction using DNeasy Blood and Tissue Kit (QIAGEN) per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Template DNA was degraded using RQ1 DNAse for 30 min at 4°C and RNA was purified using RNAeasy mini kit (Qiagen). 4-week-old NRG mice were injected intra-hepatically using 10 µg of RNA in a maximum volume of 50 µL of PBS+RNA and one week post injection a terminal bleed was performed ...
-
bioRxiv - Microbiology 2023Quote: ... AAGGTAATTGCGCGTGCAACT Core Facility of Max Planck Institute of Biochemistry (Martinsried, Germany), Pooled human ABCF1: (#1: AAGGGAAGGCTAAGCCTCAAA, #2: CAGAGTGTTAGCCAAATCGAT, #3: CTGGCTTAATAACTACCTCCA, #4: CCCAGCGGCTCCACTACTATA) (Qiagen), Pooled murine ABCF1 (#1 ...
-
bioRxiv - Neuroscience 2023Quote: ... The remaining cells were pelleted at 1000 x g for 10 minutes at 4°C and lysed in 350 µL of Buffer RLT (Qiagen) supplemented with 3.5 µL of 2-β mercaptoethanol (#444203 ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1.5 h in 50 mL conical tubes ...
-
bioRxiv - Biochemistry 2023Quote: A kinome-wide siRNA library that contained 4 individually arrayed siRNA sequences in 384-well plates was purchased from Qiagen. The library consisted of known kinases and associated proteins ...
-
bioRxiv - Microbiology 2023Quote: ... Sample DNA was extracted from microbiome samples using the PowerSoil DNA extraction kit (Cat. No. 12955-4, Qiagen, Valencia, California). Marker genes in isolated DNA were polymerase chain reaction (PCR)-amplified using GoTaq Master Mix (Cat ...
-
Sweetwater: an underrated crude glycerol for sustainable lipid production in non-conventional yeastsbioRxiv - Systems Biology 2023Quote: ... tubes were vortexed for 15 s and submitted to cell disruption for 15-min at 4°C using a TissueLyser II (Qiagen) at 30 Hz ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were selected in puromycin (1 μg/ml) the next day and after 4 days genomic DNA was extracted using DNeasy Blood and Tissue kit (Qiagen). Genomic DNA was sonicated to an average size of 500 bp using S2 Focused-ultrasonicator (Covaris ...
-
bioRxiv - Neuroscience 2023Quote: ... Amplicons were size-verified on a 4% agarose gel and PCR amplicons were extracted and purified (Qiaquick Gel Extraction Kit, Qiagen) before indexing (Nextera XT ...
-
bioRxiv - Pathology 2023Quote: ... tissue and cells were lysed in RIPA lysis buffer supplemented with orthovanadate and a cocktail of protease inhibitors at 4°C (using a TissueLyser (Qiagen) to homogenize liver tissue ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting total cell lysate was clarified by centrifugation (30,000 g for 25 min) and the supernatant fraction was applied to a 4 mL packed Ni-NTA resin (Qiagen) and gently rocked at 4 °C for 1 h in 50 mL conical tubes ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates were centrifuged for 30 min at 38,000 g and 4°C and cleared supernatants loaded onto Ni-NTA columns with 0.5 mL bed volume (1018244 Qiagen, Germany). The columns were washed sequentially with 3 column volumes (CV ...
-
bioRxiv - Molecular Biology 2023Quote: ... The resulting samples were supplemented with 300 mM NaCl and 10 mM imidazole and incubated overnight at 4 °C on a stirring wheel with 50 µl Ni-NTA agarose resin slurry (QIAGEN) pre-equilibrated with wash buffer I (50 mM Tris-HCl pH 7.8 ...
-
bioRxiv - Microbiology 2023Quote: ... Pellets were washed in 2 mL cold 10 mM NaCl + 4 mL cold RNAprotect Bacteria Reagent (Qiagen Cat. No. 76506) and repelletted at 4,255 x g ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then samples and inputs were incubated for 4 hr at 37°C with 1.5 µl of 10 mg/ml RNase A (Qiagen, 1007885) and 15 µl 10% sodium dodecyl sulfate and 3.5 µl 20 mg/ml Proteinase K (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... PCR was performed with 2 µL (∼16 ng) or 4 µL (∼32 ng) of BT-converted DNA with HotStar Taq Polymerase (Qiagen), depending on the genomic region ...