Labshake search
Citations for Qiagen :
151 - 200 of 10000+ citations for C Reactive Protein CRP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total RNA was extracted from 10 samples (5♀♀, 5♂♂) using RNeasy Micro kits (QIAGEN K.K., Tokyo, Japan) following the manufacturer’s instructions ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... RNA and protein were extracted 6 days post-transduction using the AllPrep RNA/Protein kit (Cat: 80204, Qiagen, Germantown, MD USA). RNA was converted to cDNA using SuperScript IV cDNA Synthesis Kit (Cat ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Microbiology 2020Quote: ... Purified extracellular WT and Δtgif2k-b tachyzoites were treated with vehicle or 5 μM sodium arsenite for 2 h at 37°C and total RNA was extracted using RNeasy (Qiagen). The RNA concentration for each sample was measured using Nanodrop One (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... The reaction was stopped using 15mM EDTA followed by incubation at 65°C for 5-7 min and purification on RNAeasy column (Qiagen). The purified RNA samples were processed for preparations of cDNA libraries using the TruSeq Stranded Total RNA Ribo-Zero H/M/R (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were lysed by boiling (5 min 95°C) followed by bead beating (3mm beads, 30 Hz for 1 min) (TissueLyser II, Qiagen) and sonication bath (3×10 sec at 4°C ...
-
Identification and biochemical characterization of a novel eukaryotic-like Ser/Thr kinase in E. colibioRxiv - Microbiology 2020Quote: ... Lysates were cleared by centrifugation at 15000 x g for 30 min at 4 °C and incubated in Pierce 5 ml columns with Ni-NTA agarose beads (Qiagen) at 4 °C for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Cells were rinsed at rested at 37°C for a minimum of 1h before undergoing red-blood-cell lysis by 5-10 ml RBC lysis solution (Qiagen) for 20 min at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... Cell debris was cleared by centrifugation at 40,000 g for 45 min at 4°C and supernatant was applied to His-tag affinity purification using Ni-NTA agarose (beads or 5 ml column, Qiagen) in buffer A (50 mM TRIS ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant was incubated for 30 min at 4 °C with 5 mL of Ni2+-beads (Qiagen Ni-NTA Superflow) equilibrated in lysis buffer ...
-
bioRxiv - Biophysics 2023Quote: ... and precipitated with ammonium sulfate as in Niu et al.49.The precipitate was dissolved in 30 ml buffer C and loaded onto a 5 ml column of Ni-NTA-agarose (Qiagen) pre-equilibrated in buffer C ...
-
bioRxiv - Genomics 2022Quote: ... We incubated the reaction for 5 minutes at 55 °C in a G-Storm GS1 (G-Storm) thermal cycler and after incubation added 5 μl Buffer PB (19066, QIAGEN) to inactivate and strip the transposase from the tagmented DNA ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysate was clarified by centrifugation at 5 °C at 18500 rpm for 30 min and loaded to gravity flow Ni-NTA agarose resin (QIAGEN) previously equilibrated with wash buffer WB3_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were clarified by centrifugation at 5 °C at 18 500 rpm for 30 min and loaded to gravity flow Ni-NTA agarose resin (QIAGEN) previously equilibrated with wash buffer WB2_1 (50 mM Tris-HCl pH 8 ...
-
bioRxiv - Cancer Biology 2023Quote: ... fresh 5 mM DTT) and incubated for 45 minutes at 65°C before addition of 40 μg Proteinase K (Qiagen) and further incubation for 1.5 hours at 37°C ...
-
bioRxiv - Microbiology 2024Quote: ... Bacteria are harvested by centrifugation (5 minutes, 4°C) and washed with 1 ml cold PBS containing RNA stabilization reagents (RNAprotect, Qiagen) before flash freezing and storage at -80°C ...
-
bioRxiv - Microbiology 2020Quote: ... bearing a C-terminal histidine tag (ACRO Biosystems, Newark, NJ) was coated at 2 μg/ml on a Ni-NTA plate (Qiagen, Valencia, CA). After washing and blocking ...
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... C-terminal His-tagged proteins were purified by gravity-flow chromatography on a nickel nitrilotriacetate (Ni-NTA) agarose resin (Qiagen) according to the manufacturer’s recommendations followed by an exclusion chromatography on a Superdex75 column connected to an ÄKTA Purifier™ (GE Healthcare) ...
-
bioRxiv - Biophysics 2020Quote: ... 45 min at 4 °C) and supernatant containing His-tagged proteins were purified by nickel-nitrilotriacetic acid (Ni-NTA) purification (Qiagen). Protein was eluted in a final elution buffer of 20 mM Tris pH 8.0 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Tumour samples were fresh-frozen in liquid nitrogen and stored at -80°C for protein isolation or preserved in RNAlater solution (Qiagen) for RNA isolation ...
-
bioRxiv - Genomics 2019Quote: ... We used a 100 µm nozzle to sort single cells into 96-well plates containing 5 µl TCL buffer (Qiagen) with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2020Quote: ... followed by flow sorting with a Sony SH800Z (gating on calcein NVOC fluorescence levels) into individual wells of a 96-well plate containing 5 μL of Buffer RLT (Qiagen) and 1% β-mercaptoethanol.
-
bioRxiv - Cancer Biology 2023Quote: ... we FACS-sorted single nuclei in 384-well plates prefilled with 5 μL of Vapor-Lock (Qiagen, cat. no. 981611) per well ...
-
bioRxiv - Microbiology 2021Quote: ... Protein lysates were separated on NuPage 5-12% Bis-Tris or 3-8% Tris-Acetate gels (Novex, Qiagen) using MES running buffer (Novex ...
-
bioRxiv - Developmental Biology 2021Quote: Log fold-change values of the top 5% proteins were used as input for Ingenuity Pathway Analysis (Qiagen: https://digitalinsights.qiagen.com/products/features/) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins were eluted using an imidazole gradient and subsequently loaded onto a 5 ml StrepTactin Superflow Cartridge (Qiagen) at a flow rate of 0.8 ml/min ...
-
bioRxiv - Microbiology 2023Quote: Genomic bacterial DNA was isolated from overnight grown cultures (LB, 37°C) by the DNA Extraction kit (DNeasy Kit, Qiagen Germany) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... for 30 min at 37°C and cleaned using the RNeasy Plant Mini kit (Qiagen). The quality and quantity of RNA were assayed using an Agilent RNA 6000 Nano Kit Bioanalyzer chip (Agilent Technologies) ...
-
Chromatin accessibility changes at intergenic regions associates with ovarian cancer drug resistancebioRxiv - Cancer Biology 2021Quote: ... at 37°C for 10 minutes before purification using the MinElute PCR cleanup kit (Qiagen). Isolated DNA was run on TapeStation High Sensitivity DNA tape (Agilent) ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 15 minutes at 37°C and then purified using QIAquick PCR Purification Kit (Qiagen). Inserts were ligated into vectors using Golden Gate assembly ...
-
bioRxiv - Microbiology 2020Quote: ... for 30 min at 37°C before purification with the RNeasy MiniElute Cleanup kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 37°C overnight followed by plasmid DNA purification using a HiSpeed Plasmid Midi Kit (Qiagen).
-
bioRxiv - Biochemistry 2020Quote: ... 37°C overnight followed by plasmid DNA purification using a QIAprep Spin Miniprep Kit (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
Variation in Leishmania chemokine suppression driven by diversification of the GP63 virulence factorbioRxiv - Microbiology 2021Quote: ... and stored at -80°C prior to extracting RNA with RNeasy RNA extraction kit (Qiagen). Reverse transcriptase was performed using iScript Reverse Transcriptase kit (BioRad ...
-
bioRxiv - Microbiology 2019Quote: ... at 37°C for 30 min and were re-purified using RNeasy mini kit (Qiagen). RNA concentrations were determined using Nanodrop ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 minutes at 37°C and purified with Minelute PCR Purification Kit (Qiagen, 28004) to produce tagmented DNA samples ...
-
bioRxiv - Plant Biology 2020Quote: Total RNA isolated from 3-week-old thalli (QIAGEN RNAeasy Plant Kit 5) from each genotype was assessed for quality with a Nanodrop spectrophotometer and a Bioanalyzer 2100 microfluidics system (Agilent 6) ...
-
bioRxiv - Immunology 2021Quote: RNA was isolated from ~5 x 105 cells using RNeasy mini kits (Qiagen), typically yielding 100-400 ng RNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was isolated from 5 million cells using the DNAeasy kit (Qiagen). 4ug gDNA was digested with NlaIII or MseI ...
-
bioRxiv - Immunology 2019Quote: ... total RNA (5 mice per group) was extracted using RNeasy Micro Kit (QIAGEN). Samples were sent to Admera Health for sequencing and analysis ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from 5 ml samples using the miRNAeasy mini kit (Qiagen), treated with TURBO DNase (Ambion ...
-
bioRxiv - Molecular Biology 2023Quote: mRNA was extracted from ∼5×106 cells using the miRNeasy Mini Kit (QIAGEN). Library preparation and sequencing was conducted by City of Hope Integrative Genomics Core ...
-
bioRxiv - Cell Biology 2023Quote: ... Total RNA from 5×107 cells was extracted using RNeasy mini kit (Qiagen). One μg total RNA was used for cDNA synthesis using Quantinova Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Genomics 2019Quote: ... Plates grown in parallel were used for genomic DNA extraction (DNeasy Blood & Tissue kit, Qiagen), and RNA extraction (TRIzol ...
-
bioRxiv - Cancer Biology 2021Quote: ... Amplification of cDNA for validation of doxycycline induction was performed with U2AF1 primers (forward: 5’-GGCACCGAGAAAGACAAAGT-3’; reverse: 5’-CTCTGGAAATGGGCTTCAAA-3’) and PCR products were purified using QIAquick PCR purification kit (QIAGEN, Cat #28104) before Sanger sequencing ...
-
bioRxiv - Neuroscience 2020Quote: Total RNA was extracted from all samples (5 CTRL and 5 SCZ subjects at six timepoints across astrocyte differentiation) using either the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) or the MagMax mirVana Total RNA Isolation Kit (Thermo Fisher) ...