Labshake search
Citations for Qiagen :
301 - 350 of 807 citations for C C Motif Chemokine Ligand 23 CCL23 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... All samples were stored at -80°C until the DNA was extracted using the DNeasy PowerSoil Pro Kit (Qiagen). A blank DNA extraction was included to account for possible contaminations ...
-
bioRxiv - Microbiology 2024Quote: ... Lysates were clarified by centrifugation at 21,000× g at 4°C and loaded onto gravity flow Ni-NTA agarose columns (Qiagen), followed by washing with 50 mM HEPES pH 7.5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell lysates were further transferred to liquid N2/ -80 °C freezer before RNA purification according to Qiagen protocol (www.Qiagen.com ...
-
bioRxiv - Microbiology 2023Quote: RNA samples from the Ag43 experiment were subjected to the QIAseq Fast Select -5s/16s/23s kit (QIAGEN) for ribosomal RNA depletion according to manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... rRNA depletion sequencing library was prepared by using QIAGEN Fastselect rRNA 5S/16S/23S Kit (Qiagen, Hilden, Germany). Strand-specific RNA sequencing library was prepared by using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina following manufacturer’s instructions (NEB ...
-
bioRxiv - Immunology 2024Quote: ... T157I mutations (23) were produced by Hi5 insect cells and extracted from culture supernatant using Ni-NTA (Qiagen). HLA-DR monomers were biotinylated overnight at 4°C using BirA biotin ligase (Avidity ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were sent to Glasgow Polyomics for ribosomal depletion using a QIAseq FastSelect 5S/16S/23S Kit (Qiagen), cDNA library preparation using a TruSeq Stranded Total RNA Library Prep Gold (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... which is based on the expression of known ligand-receptor pairs112.Gene lists were imported into the IPA software Ingenuity Pathway Analysis (IPA) 01.12 (Qiagen Bioinformatics) to assess pathway/biological function enrichment analysis.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were harvested by centrifugation at 4°C followed by cell lysis/RNA extraction using RNEasy plus mini kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Cancer Biology 2021Quote: Protein lysate [1μg/μL] was RNase A digested at 37°C for 15 min following addition of 1 μg RNase A (Qiagen) per 25 μg protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... Inoculants from glycerol stocks or stab culture were cultured overnight in liquid LB at 37°C and plasmids were extracted using Plasmid miniprep kit (Qiagen). See Key Resources Table for shRNA identity ...
-
bioRxiv - Immunology 2021Quote: Conditioned medium of HEK293 cells producing recombinant sema3A fused with 6xHistidine tag in C-terminal was collected and purified using Ni-NTA agarose beads (QIAGEN). The protein activity was assessed using the cytoskeleton collapse assay (19 ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA was further digested with TURBO DNase overnight at 37°C (10 U per 2 μg of RNA) and purified with the RNeasy MinElute Cleanup Kit (Qiagen) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2021Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 200,000 g for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Developmental Biology 2021Quote: ... The samples were incubated at 37 °C for 16 hours overnight and were in turn cleaned-up using the QIAquick PCR Purification kit (QIAGEN) and eluted with 40 μl of 50 °C water ...
-
bioRxiv - Genetics 2020Quote: ... Ligation was carried out overnight at 16°C followed by overnight cross-link removal with 20mg/ml Proteinase K (Qiagen). The samples were purified using phenol-chloroform and ethanol precipitated resulting in 3C libraries ...
-
bioRxiv - Microbiology 2019Quote: ... snap frozen on dry ice and stored at −80°C until RNA purification with the Qiagen AllPrep RNA/DNA kit (Qiagen). Immunoglobulin amplicon preparation ...
-
bioRxiv - Genomics 2020Quote: ... 25ng of the purified product was subjected to self-ligation at 16 °C overnight in a total volume of 50uls and column purified using Qiagen (Qiagen) PCR purification kit as per manufacturers recommendations ...
-
bioRxiv - Molecular Biology 2021Quote: ... Five colonies with the correct sized insert were inoculated into liquid LB supplemented with spectinomycin and chloramphenicol and grown overnight at 37°C for plasmid extraction using a QIAprep Spin Miniprep Kit (Qiagen). The plasmid constructs were confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets were resuspended in lysis buffer and stored at -80°C before DNA or total RNA extraction with the Genomic DNA Mini (Blood/Culture Cell) (Genesis) or mRNAeasy (Qiagen) kits ...
-
bioRxiv - Biophysics 2022Quote: ... Purified protein was diluted in PBS buffer (pH = 7.2) and the fluorescence intensity was recorded at 60 °C in the Rotor-Gene 6600 real-time PCR cycler (Qiagen) for 18 h ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2020Quote: ... We stored tissue at 4 °C for 24-72 hours prior to extracting DNA with a DNAeasy Blood and Tissue Kit (Qiagen) with on-column RNase A treatment following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Tissue samples were snap frozen in liquid Nitrogen and stored at −80 °C until genomic DNA (gDNA) was extracted using DNeasy blood and tissue kit (QIAGEN). Tissues were lysed in 360 µL of lysis solution on a Precellys 24 homogenizer for 30s at 4.0 ms−1 ...
-
bioRxiv - Microbiology 2019Quote: ... medium at 37°C and was made competent with rubidium chloride according to the method provided in the QIAexpressionist manual protocol 2 (Qiagen). When antibiotic selection was required ...
-
bioRxiv - Genomics 2019Quote: ... transposition was performed on 25,000 sorted tetraploid nuclei at 37°C for 30 minutes followed by DNA purification with the MinElute Reaction Cleanup Kit (28206, QIAGEN). DNA fragments were PCR preamplified for 5 cycles initially ...
-
bioRxiv - Neuroscience 2019Quote: ... EST plasmids were grown in Luria Bertani (LB) media overnight at 37°C and purified before further use (QIAprep Spin Miniprep Kit, Qiagen). Plasmids were linearized with PauI (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: ... After 16 hrs in a 37°C shaker bacteria were harvested and plasmid DNA was isolated using a Megaprep kit (Qiagen). ITR integrity was confirmed by digestion with XmaI as well as with AhdI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cross-linking was reversed by incubation overnight at 65 °C and DNA was purified using a MinElute PCR purification kit (Qiagen). All IP DNA and 1 ng of input DNA were used for library preparation using the ThruPLEX-FD Prep Kit or ThruPLEX DNA-Seq (Rubicon Genomics) ...
-
bioRxiv - Developmental Biology 2020Quote: ... In vitro transcribed mRNAs were DNAse-treated using TURBO-DNAse for 15 min at 37°C and purified using the RNeasy Mini Kit (Qiagen) and quantifed using Qubit™ RNA BR Assay Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2019Quote: The decellularized Balb/c mouse pancreas scaffolds were washed in PBS and homogenized-lysed for 1 hr in Tissue homozilyser II (Qiagen). The ECM proteins were dissolved in lysis buffer containing Tris HCl 0.06M ...
-
bioRxiv - Genetics 2019Quote: ... Crosslinking was then reversed by overnight incubation at 65°C and DNA purified using QIAquick PCR purification column (Qiagen, 28104). Immunoprecipitated DNA was then quantified via Qubit (ThermoFisher ...
-
bioRxiv - Systems Biology 2020Quote: ... cultures were harvested in RLT buffer and stored at −80°C before isolation of RNA using the RNeasy Mini Kit (Qiagen). mRNA was isolated from 1 ug total RNA by poly-dT enrichment using the NEBNext Polya ...
-
bioRxiv - Genetics 2019Quote: ... Cross-links were reversed at 65°C overnight (16 hrs) and DNA was purified using a PCR purification kit (Qiagen). DNA content was quantified by RT-PCR using iTaq Universal SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Physiology 2019Quote: ... 72 °C - 10 min) and amplicons separated using a Qiaxcel Advanced Separation System using 15 - 3000 bp markers (Qiagen, UK).
-
bioRxiv - Genomics 2019Quote: ... The transposition reaction was performed at 37°C for 30 min and was followed by purification of the samples using the Qiagen MinElute PCR purification kit (Qiagen). Transposed DNA fragments were amplified for 11 cycles using the NEBnext high-fidelity PCR master mix and the Ad1_noMX and Ad2.1-2.6 barcoded primers from (10) ...
-
bioRxiv - Biochemistry 2021Quote: ... The insoluble fraction was precipitated by ultracentrifugation (20,000 g) for 30 minutes at 4°C and the supernatant was loaded onto a Ni-NTA superflow affinity column (QIAGEN). The Ni-column was then wash three times and eluted with buffer containing 30 mM HEPES (pH 7.8) ...
-
bioRxiv - Immunology 2021Quote: ... Samples were then centrifuged and plasma isolated and stored at -20°C prior to testing in the QuantiFERON IFNγ ELISA (Qiagen). Acceptance criteria for the assay specified by manufacturers were always met.
-
bioRxiv - Neuroscience 2020Quote: ... at 60°C overnight and 1 μl of a 1:20 dilution of the lysate used in a PCR reaction (HotStarTaq, Qiagen). The sequence flanking the tmt-opsin1b TALEN binding sites was amplified using the forward 5’-GGGACTTTCTTTGCGCTTTA-3’ and the reverse 5’-CAGGTCAGAGCGGATCTCAT-3’ primers ...
-
bioRxiv - Cell Biology 2021Quote: The input and immunoprecipitated DNA were incubated in the same buffer with the addition of 20 μg Protease K at 65 °C overnight to reverse crosslinks before purification using a QIAquick PCR Purification kit (QIAGEN). Before qPCR analysis ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns were used for a 2 L culture in which the lysate was loaded on the column washed with 10 CV wash buffer (50 mM Hepes ...
-
bioRxiv - Biochemistry 2021Quote: ... the cell lysate was cleared by centrifugation (20000 rpm, 30 minutes, 4 °C) and purified using Ni2+-affinity chromatography (Ni-NTA superflow cartridges, Qiagen). Typically two 5 mL columns (flow 5 mL/min ...
-
bioRxiv - Biochemistry 2020Quote: Initial crystals of Nup133NTD-VHH-SAN5 were obtained at 18°C in 1 day as part of the Protein Complex suite (Qiagen) in a 96-well sitting drop tray with a reservoir containing 15% PEG MME 2,000 ...
-
bioRxiv - Bioengineering 2021Quote: ... Exosome samples were treated with 1 µL RNAse A/T1 per 100 µL sample for 30 min at 37°C and lysed in 650 µL of QIAzol (Qiagen). To monitor the RNA recovery percentage as a function of the isolation procedure ...
-
bioRxiv - Bioengineering 2020Quote: ... The PCR fragments were incubated with DpnI for 2 h at 37°C to degrade the template plasmids before being purified using a PCR purification kit (Qiagen). The purified PCR fragments were digested overnight at 37°C using NheI and XhoI and ligated overnight at 16°C to backbone vector pYZ125 ...
-
bioRxiv - Biochemistry 2020Quote: ... The supernatant obtained after high speed centrifugation (20 000 x g for 30 min at 4 °C) was loaded on a gravity nickel-nitrilotriacetic acid (Ni-NTA) metal affinity column (Qiagen), washed with 10 column volumes (CV ...
-
bioRxiv - Cancer Biology 2021Quote: ... and storing at −80°C.68 DNA extraction of tumor tissue from FFPE was carried out using QIAGEN FFPE DNA extraction kit (QIAGEN). DNA was extracted from plasma and buffy coat using Macherey-Nagel NucleoSnap and QIAGEN Blood and Tissue kits ...
-
bioRxiv - Plant Biology 2021Quote: Plant samples of ∼50 mg were frozen in liquid nitrogen and stored at −80°C prior to RNA extraction with RNeasy Plant Mini Kit and on-column RNase-Free DNase Set (Qiagen). Total RNA (0.5 µg ...
-
bioRxiv - Plant Biology 2021Quote: ... The translation mixture was gently agitated in a microtube for 1 h at 4°C with a fivefold volume of Ni-NTA agarose (Qiagen) that had been equilibrated with a solution containing 50 mM Tris-HCl (pH 7.5 ...