Labshake search
Citations for Qiagen :
401 - 450 of 10000+ citations for Atrial Natriuretic Peptide ANP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... The target protein was eluted by 0.2 mg/ml FLAG peptide and load to Ni-NTA affinity gel (Qiagen). After washed by Lysis Buffer supplied with 0.02% GDN and 0.004% CHS ...
-
bioRxiv - Microbiology 2020Quote: ... Crystals of Brd4(BD1) with YFV-C (1-10) K4ac peptide were grown from a solution containing 0.2 M sodium chloride (QIAGEN), 0.1 M Tris (pH 7.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled ORC were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer B with 10 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Peak fractions containing peptide-coupled Cdt1 were pooled and incubated with 0.3 mL of Ni-NTA Agarose Resin (Qiagen) pre-equilibrated in buffer D with 10 mM imidazole for 1.5 hr with rotation at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... Reactions were run in a total volume of 10 μl having 5 μl Rotor-Gene SYBR® Green PCR Kit (Qiagen, NSW, Australia), 0.3 μl each of 10 μM forward and reverse primer and 2 μl of genomic DNA ...
-
bioRxiv - Plant Biology 2021Quote: ... and sunflower_KTI _R (5’ – CTACTCAGATTGAACAGAAGCCAC- 3’were designed and used in a PCR reaction with total DNA extracted (DNeasy Plant Mini Kit, Qiagen, Valencia CA USA) from sunflower leaf tissue ...
-
bioRxiv - Microbiology 2021Quote: ... Intact bacterial cells were pelleted by centrifugation at 10,000 x g for 5 min at room temp and DNA extracted from the pellet using a DNeasy® Blood & Tissue kit (Qiagen, Hilden, Germany). DNA concentration was assessed by the QubitTM dsDNA BR Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Following the manufacturer’s instructions RNA was reverse-transcribed in a 20 μl reaction volume (42°C, 30 min; 95°C, 5 min) using a QuantiTect Reverse Transcription Kit (Qiagen, Valencia, CA, USA). cDNA was then amplified using a SYBR Green I Master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... we pooled 1.5 mg RNA from each sample (mixed-stage, male-enriched, and starved) and used the RNeasy MinElute Cleanup kit (Qiagen, catalog no. 74204) to further purify and concentrate the pooled RNA ...
-
bioRxiv - Immunology 2022Quote: ... Cells were centrifuged for 5 minutes at 300xg and pellets resuspended in Buffer RLT Plus (RNeasy Plus Mini Kit from Qiagen, Germantown, MD, USA), and frozen at −80°C ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were harvested (1×106) by centrifugation (200 x g for 5 min at 25°C. Whole RNA was isolated using the Qiagen RNeasy kit (Qiagen) according to the manufacturer’s description ...
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was extracted from 5 to 10 million cells or 15 to 25 mg of tissue using the MagAttract HMW DNA kit (Qiagen N.V., Venlo, Netherlands) according to the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Developmental Biology 2021Quote: ... One 5 mm ∅ metal bead (Qiagen) and 500 µl Qiazol (Qiagen ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μL of Ni-NTA (Qiagen) slurry was added and the solution was incubated with light agitation at 4 °C for 50 min ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 5 μL Qiagen master mix (Qiagen Type-It Microsatellite Kit ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 5 μL 10X PCR buffer (Qiagen), and nuclease-free water to a final volume of 50 μL ...
-
bioRxiv - Cell Biology 2021Quote: ... si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’, Qiagen), si-uS19 (5’-UCACCUACAAGCCCGUAAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-eS4X (5’-CUGGAGGUGCUAACCUAGGAA-3’, Qiagen), si-FAU (5’-CCGGCGCUUUGUCAACGUUGU-3’ ...
-
bioRxiv - Genomics 2021Quote: ... containing 5 µl RLT plus (Qiagen) with 1% v/v β-mercaptoethanol (Biorad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... with one 5 mm (Qiagen, 69989) and three 2.8 mm metal beads (Precellys ...
-
bioRxiv - Cell Biology 2023Quote: ... #4: 5’-CCGGTTTAGCTGAAGATTCAA-3’ (SI00443779, Qiagen), GTPBP10 siRNA 5’-TTGCGTGTTGTTCAGAAAGTA-3’ (SI04308647 ...
-
bioRxiv - Cell Biology 2023Quote: ... #3: 5’-AAGCATCGATAGGTAAGTTGA-3’ (SI03130008, Qiagen); #4 ...
-
bioRxiv - Evolutionary Biology 2019Quote: We extracted whole genomic DNA from 5 individuals per line using a Qiagen® DNEasy Blood and Tissue Kit (Qiagen, Inc., Valencia, CA, USA), following a modified version of the mouse-tail protocol ...
-
bioRxiv - Genetics 2022Quote: ... 5 μl of each sample was pooled into one of 5 indexed libraries and PCR purified using a QIAquick PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). Prior to preparing individuals for next generation sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... Reactions were quenched at different time points (2, 5, 7, 10 and 20 minutes) by the addition of 250 μL of PB buffer (Qiagen QIAquick PCR Purification Kit) supplemented with 10 mM of EGTA ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with 5 µl proteinase K (20 mg/ml) and lysed overnight at 56°C under shaking in Cell Lysis Solution (Qiagen Gentra Puregen Cell kit) with proteinase K (20 mg/ml) ...
-
bioRxiv - Genomics 2020Quote: ... Obtained fully tryptic peptides were mapped to the secalin and nsLTP sequences in CLC Genomics Workbench v12 (Qiagen, Aarhus, Denmark) using 100% sequence identity to confirm the expression at individual protein levels.
-
bioRxiv - Microbiology 2023Quote: ... incubated at 65°C for 5 min and beaten for 5 min in a bead beater (Qiagen) set at high speed ...
-
bioRxiv - Microbiology 2019Quote: ... with two sets of 96-well adapter plates (QIAGEN) containing 2 ml microcentrifuge tubes (QIAGEN ...
-
bioRxiv - Cancer Biology 2020Quote: ... The plate was loaded with a QIAgility Robot (Qiagen) and run on 7500 Fast Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... EasyXtal 15-well Tool crystal plates (Qiagen, Manchester, UK) were set up manually for HAdV-D15 ...
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Genomics 2022Quote: An aliquot of 150 μL of plasma per sample was thawed on ice and centrifuged at 3000 × g for 5 min at 4 °C and smallRNA was extracted using miRNeasy Serum/Plasma Kits (Qiagen, Cat. No. 217184, Milano, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’; Qiagen), si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-3 (5’-AACACAGCUUCUGUUGACUCU-3’, Qiagen), si-USP10-4 (5’-AAGAACUAGUUCUUACUUCAA-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-4 (5’-UUCCUUGUGAGUAGCUCUCAA-3’; Qiagen), si-XPO1 (5’-UGUGGUGAAUUGCUUAUAC-3’).
-
bioRxiv - Cell Biology 2021Quote: ... si-USP36-2 (5’-UCCGUAUAUGUCCCAGAAUAA-3’; Qiagen), si-USP36-3 (5’-CCGCAUCGAGAUGCCAUGCAU-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... si-USP10-1 (5’-UCGCUUUGGAUGGAAGUUCUA-3’, Qiagen), si-USP10-2 (5’-UACGUCAACACCCAUGAUAGA-3’ ...