Labshake search
Citations for Qiagen :
201 - 250 of 10000+ citations for Atrial Natriuretic Peptide ANP ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: Total RNA from ~ 5 × 105 neutrophils (CD45+Lin-CD11b+Ly6G+) was isolated with the RNeasy micro kit (Qiagen) and RNA quality was checked with the Agilent 2100 Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’ taaccgatgttgggcatcag 3’) using one-step RT-qPCR with either QuantiFast SYBR Green RT-PCR Kit (Qiagen, MD) or QuantiNova SYBR Green RT-PCR Kit (Qiagen ...
-
bioRxiv - Plant Biology 2023Quote: Total RNA from 5-day-old whole plants was extracted using the RNeasy Plant Mini Kit (Qiagen, 74904). For RNA-seq ...
-
bioRxiv - Microbiology 2023Quote: ... DNA was extracted from 5-10 g of soil per sample with the DNeasy PowerMax Soil Kit (Qiagen) and used for short read and long read sequencing ...
-
bioRxiv - Immunology 2023Quote: RNA was extracted from 5 x 106 T cells using the RNeasy® Mini Kit (Qiagen, Cat. 74106). RNA extraction was performed following the instructions from the “Purification of Total RNA from Animal Cells Using Spin Technology” protocol given in the RNeasy® Mini Handbook ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). The remaining 95 mL of culture was combined with 40.7 mL 50% glycerol (v/v) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmid DNA was extracted from 5 mL of this culture using the QIAprep Spin Miniprep Kit (Qiagen, 27104). Glycerol was added to the remaining culture to a final concentration of 15% (v/v ...
-
bioRxiv - Immunology 2023Quote: RNA was purified from at least 5 x 104 CD4+ T cells using the RNeasy Micro kit (Qiagen). cDNA was synthesized using the SuperScriptTMVILOTMcDNA synthesis kit (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR amplification was carried out in 5 µl reactions using the QIAGEN Multiplex PCR Kit (QIAGEN, Germany). Each sample reaction contained 10–20 ng of genomic template DNA ...
-
bioRxiv - Immunology 2022Quote: Ni-NTA HisSorb plates (Qiagen) were coated with 50ng/well of S1 proteins (all from Sino Biological ...
-
bioRxiv - Microbiology 2021Quote: Ni-NTA HisSorb plates (Qiagen) were incubated with soluble gH/gL/gO complexes tagged with 6-His overnight at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... using Powerbead Pro Plates (Qiagen) with 0.5mm and 0.1mm ceramic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Neuroscience 2022Quote: E3 and E4 primary microglia were plated at 5×106 cells/well in 6-well plates and RNA was extracted from the cells using the RNEasy Plus Mini Kit (Qiagen #74136) and converted to cDNA using High-Capacity RNA-to-cDNA kit (Thermo #4387406 ...
-
bioRxiv - Cell Biology 2022Quote: ... Total RNA from cells in a single well of a 6-well plate was isolated using the RNeasy Plus Mini Kit (Qiagen, 74134) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2019Quote: RNA from myotubes grown in 6-well plates in conditions described above was isolated using the RNeasy Micro Kit from Qiagen (#74004). Quality of RNA was assessed by using a Bioanalyzer 2100 and samples were submitted for library preparation and deep sequencing to the Molecular biology core facility at the Dana Farber Cancer Institute ...
-
bioRxiv - Evolutionary Biology 2020Quote: Total RNA was extracted from cells (1-2 wells, 6 well plate) using an RNeasy Plus Mini Kit (Qiagen, Hilden, Germany), including a DNase step to remove residual DNA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Total RNA was isolated from iPSC-SNs seeded in 6-well plates using a RNeasy Mini Kit (Qiagen, Redwood City, CA) and reverse transcribed into cDNA using a SuperScript VILO cDNA Synthesis kit (Life Technologies ...
-
bioRxiv - Cell Biology 2021Quote: Cells were grown to 80% confluence in a 6-well plate before RNA was extracted using standard RNA extraction protocol (RNAeasy Mini Kit, Qiagen, #74104). cDNA synthesis was performed by mixing 1μg of RNA with qScript® cDNA Synthesis Kit (Quantabio ...
-
bioRxiv - Microbiology 2021Quote: DNA from plate-well pools of the progenitor collection was isolated with a DNeasy 96 Blood &Tissue Kit (Qiagen, Cat. #69582) according to manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: Total RNA was extracted from iPSC-SNs seeded in 12-well plates using RNeasy Mini Kit (74106, Qiagen AB, Stockholm, Sweden) with DNase digestion (79256 ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... Colonies were transferred to 96-well plates and grown until a sufficient number of cells was reached for genomic DNA (DNeasy Blood & Tissue Kit; Qiagen, #69504) and protein extraction ...
-
bioRxiv - Biochemistry 2024Quote: Total RNA was isolated from cells grown in six-well plates at 70–80% confluency with an RNA extraction kit (Qiagen #74104). cDNA was synthesized using a sensiFAST cDNA synthesis kit (Meridian Bioscience #BIO-65053) ...
-
bioRxiv - Cell Biology 2019Quote: ... brefeldin A (2.5 μg/mL) and MG132 (2.5 μM) for 24 hr prior to RNA isolation with RNAeasy Mini Kit (Qiagen). One μg of purified RNA was reverse transcribed into cDNA using the Protoscript II Reverse Transcriptase kit (New England Biolabs) ...
-
bioRxiv - Genetics 2021Quote: ... The 10 μL reaction was carried out with 40 ng genomic DNA and 0.2 μM of each primer and 5 mM Multiplex PCR Kit (Qiagen). Cycling conditions were identical for both directions with 95°C 15:30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction was stopped by adding 2.5 uL of 0.5M EDTA pH 8 and transposed DNA was purified using Qiagen MiniElute PCR purification kit (Qiagen). Purified DNA was amplified using the following condition ...
-
bioRxiv - Immunology 2022Quote: For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... n=4 females [hybrid cross] and n=5 females [conspecific cross]) using the AllPrep RNA/DNA Mini Kit (Qiagen), and was stored at −80°C until sequencing ...
-
bioRxiv - Cell Biology 2021Quote: RNA from 5-10 million NK cells treated overnight with indicated conditions was extracted using Rneasy Plus kit (Qiagen). Samples were prepared for Illumina sequencing following the manufacturer’s protocol using the TruSeq® stranded total RNA with rRNA depletion using Ribo Zero TM Human/Mouse/Rat ...
-
bioRxiv - Microbiology 2021Quote: ... 100 μl of total RNAs were extracted from 5 × 105 replicon cells using RNeasy mini kit (Qiagen, Gaithersburg, MD). 2□μl of each sample was used to assess RNA quality using Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... For RT product measurements DNA was extracted from 5×105 infected cells using the DNeasy Blood & Tissue kit (QIAgen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... Total RNA were extracted from roots 5 days after germination using the RNeasy® Plant Mini kit (Qiagen #74904) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA from 1-5 million total CD4+ T cells was isolated using the Gentra Puregene Cell Kit (Qiagen) or phenol-chloroform and the DNA concentration was measured by Qubit High Sensitivity Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... The homogenates were clarified by centrifugation at 9,000 × g for 5 min and RNA was extracted using RNeasy Mini Kit (Qiagen) following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2020Quote: ... Total RNA was isolated after disrupting worms with 5 freeze-thaws with Qiazol extraction and RNeasy mini kit (Qiagen). cDNA libraries were prepared through TruSeq Stranded mRNA kit (Illumina ...
-
bioRxiv - Developmental Biology 2019Quote: ... Total RNAs from batch of 3-5 embryos were extracted with the Rneasy® Micro Kit (Qiagen, Valencia CA). Relative quantitative PCR was performed on a QuantStudio 3 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted from 5 million transfected Jurkat T-cells using the DNeasy Blood and Tissue kit (Qiagen) and quantified by Quant-iT™ PicoGreen™ dsDNA Assay kit (ThermoFisher Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: Ovarian total RNA was extracted from 5 μl freshly dissected fly ovaries by using Qiagen RNeasy Purification Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... VDAC1P8-201 and GAPDH (Suppl. Table 5) and 12.5 μl of master mix (QuantiFast SYBR Green PCR kit, Qiagen). Analysis of relative expression level was performed using the housekeeping GAPDH gene as internal calibrator by the ΔΔCt method ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from approximately 25-50 EBs at day 5 of differentiation was isolated using RNeasy Mini kit (Qiagen) and quantified by NanoDrop (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... Lysate was centrifuged (6000rcf, 5 minutes) and genomic DNA (gDNA) extracted from pellets also using the DNeasy kit (QIAGEN). Successful gene modification events or maintenance of the wildtype loci was performed by PCR using primers listed in Table S5.
-
bioRxiv - Cell Biology 2023Quote: ... cells transfected with dsRNA were harvested after 5 days and RNA was extracted using the RNeasy Micro Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was extracted from 5-10×106 cells using the Gentra Puregene Cell Kit (Qiagen, cat no. 158046) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA and RNA from healthy tissues and lymphomas of control and STIL-transgenic mice was extracted using the All Prep DNA/RNA/Protein Mini Kit according to manufacturer’s instructions after tissue homogenization using TissueLyser II and stainless-steel beads (5 mm, all Qiagen). DNA and RNA concentrations were quantified with Qubit 2.0 using the dsDNA High Sensitivity and RNA High Sensitivity Kit (both Thermo Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted from approximately 5-10 million cells from each organ using the RNeasy Mini Kit (QIAGEN). SuperScript® IV Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Liquid cultures or swabs from agar plates from selected bacterial strains (Supplementary Data 3) were used to extract DNA using the QiAmp Micro DNA kit (Qiagen, Hilden, Germany). The extracted DNA was treated with RNase ...
-
bioRxiv - Cell Biology 2020Quote: ... All HA positive clones were amplified in a 6 well plate and genomic DNA isolated using Qiagen DNAeasy blood and tissue kit as per manufactures instructions (Qiagen, Germantown, MD) (Cat #69504) ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were lysed in the plate using 1 mL of RTL buffer from an AllPrep DNA/RNA/Protein isolation kit (Qiagen, Hilden, Germany). Experiments were performed in triplicate.
-
bioRxiv - Plant Biology 2020Quote: Quantitative real-time PCR was performed in a volume of 5 mL QuantiTect Probe PCR Kit (Qiagen GmbH, Hilden, Germany) kit and an ABI 7900HT fast real-time PCR system (ThermoFisher Scientific Inc. ...