Labshake search
Citations for Qiagen :
601 - 650 of 3702 citations for 7 PHENYL 1 2 4 TRIAZOLO 1 5 A PYRIMIDINE 6 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... 1× Type-it Multiplex PCR Master Mix (Qiagen), 0.2 μM of each locus specific reverse primers ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen, Hilden, Germany), and 0.2 μM of Primer_F3 and Primer_R (Figure S2 and Table S2) ...
-
bioRxiv - Genomics 2022Quote: ... 1 mL of buffer PB or PM (Qiagen), containing a high concentration of guanidine hydrochloride and isopropanol was added and mixed by pipetting ...
-
bioRxiv - Physiology 2022Quote: ... Samples were homogenized in 1 ml Qiazol (Qiagen) with 5 μl β-mercaptoethanol using a beadmill homogenizer cooled with liquid nitrogen and then phase separated using 1-bromo-3-chloropropane (BCP) ...
-
bioRxiv - Biophysics 2023Quote: ... Approximately 1 ml of Ni-NTA agarose (Qiagen) was utilised for purification of the lysate resulting from 1 l culture ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 mL of RNA protect reagent (76506, Qiagen) was added to 500 µL of the sample ...
-
bioRxiv - Systems Biology 2023Quote: ... 1 mL of ice-cold Qiazol (Qiagen, 79306) reagent was added and transferred into Precellys® lysing kit tubes (Keramik-kit 1.4/2.8 mm ...
-
bioRxiv - Immunology 2023Quote: ... Samples were diluted 9:1 (elution buffer (Qiagen):cDNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteinase K (20 μg·ml-1 final concentration, Qiagen) was firstly added to the relevant samples ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1% Protease Inhibitor using TissueLyser II (Qiagen) and 5 mm stainless steel beads (Qiagen ...
-
bioRxiv - Biochemistry 2024Quote: ... and anti-Strep (Qiagen, 34850, 1:1000 dilution) antibodies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Molecular Biology 2022Quote: ... FAF1 (Uniprot identifier Q9UNN5-1) and UBXN7 (Uniprot identifier O94888-1) were amplified from XpressRef Universal Total human RNA (QIAGEN, 338112) by RT-PCR (TaKaRa ...
-
rpoB, a promising marker for analyzing the diversity of bacterial communities by amplicon sequencingbioRxiv - Microbiology 2019Quote: ... and were subjected to three cycles of grinding (1 minute, at 30 Hz followed by 1 minute without agitation) in a TissueLyser II apparatus (Qiagen, France). The solutions obtained from crushed nematodes or the contents of G ...
-
bioRxiv - Genomics 2021Quote: ... DNA was extracted with 1 volume of 25:24:1 phenol-chloroform-isoamyl alcohol and purified with QIAquick PCR Purification Kit (QIAGEN 28104). Libraries were prepared with the Ovation Ultralow V2 DNA-Seq Library Preparation Kit (NuGEN (Redwood City ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated for 1 hour with monoclonal α-His antibodies conjugated to the horseradish peroxidase (1:5000 dilution; Qiagen). Blots were visualized with the addition of Lumina Forte Western HRP Substrate (MilliporeSigma ...
-
bioRxiv - Synthetic Biology 2023Quote: ... followed by incubations with a PBS-based protein binding mixture for 1 h and with Alexa488-conjugated anti-His antibody (1:20 dilution, Qiagen 35310) for 1 h ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... along with the human NaV β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.X:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Zoology 2019Quote: DNA was extracted from one individual pre-pupa that was pulled out from a cocoon sample (voucher # USDA-BRL 181221-03_G21; Fig 1-9 to 1-13) using the DNeasy Blood & Tissue Kit (Qiagen Inc., Valencia, CA), as per manufacturers protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were transiently co-transfected with NaV1.2 and the accessory β1 and β2 subunits (2 μg total plasmid DNA was transfected with a cDNA ratio of 10:1:1 for NaV1.2:β1:β2 subunits) using Qiagen SuperFect reagent (Qiagen, Valencia, CA, U.S.A.). Human β1 and β2 cDNAs were cloned into plasmids encoding the CD8 receptor (CD8-IRES-hβ1 ...
-
bioRxiv - Microbiology 2020Quote: Total RNA extraction was performed using a squash buffer (10 mM Tris base, 1 mM EDTA, 50 mM NaCl) supplemented with 1:8 part Proteinase K (Qiagen, 15mg/ml). Mosquito abdomens with the midguts and heads with thoraces were individually collected in 50 μl of squash buffer at 7 and 14 days ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA (including integrated HIV-1 DNA and episomal HIV-1 DNA) was extracted using the QIAmp blood DNA minikit (Qiagen, Courtaboeuf, France) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Evolutionary Biology 2020Quote: ... washed with 1 ml RNAprotect® Cell Reagent (Qiagen) and centrifuged for 10 min at 2,500 x g ...
-
bioRxiv - Genetics 2019Quote: ... and mouse anti-Strep (Qiagen Cat# 34850, 1:500) with goat or donkey secondary antibodies from Jackson ImmunoResearch used 1:500 ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 µl zymolyase and 1 mg/ul RNase (QIAGEN). This was incubated in a 37 °C shaker for 1 hour before the addition of Proteinase K (10 µl ...
-
bioRxiv - Physiology 2021Quote: 1 μg purified extracted RNA (RNeasy Mini Kit, Qiagen) was reverse transcribed using qScript Reverse Transcriptase (Quanta Biosciences ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL of proteinase K (20 mg/mL, Qiagen) was added and samples were incubated at RT for 10 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... mAb anti-His6 (34650; IF: 1/500) from Qiagen, mAb anti-GAPDH (GTX28245 ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse antibodies against the His-tag (1:1000, Qiagen), rabbit antibodies against the C-terminal region of the collagen VI α1 chain (1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reaction conditions were 1 × HotStar® Taq buffer (Qiagen) supplemented with 1.6 mM MgCl2 ...
-
bioRxiv - Microbiology 2019Quote: ... resuspended in 1 mL RTL buffer (Qiagen RNeasy Kit) and lysed by bead beating (2 × 1 min ...
-
bioRxiv - Neuroscience 2021Quote: ... and diluted 1:50 in TE-Buffer (Qiagen, #1018499) to a final concentration of 1.75e12 vg/ml (kindly donated by I ...
-
bioRxiv - Immunology 2021Quote: 1-3 × 105 PBMCs were lysed in QIAzol (Qiagen). Full-length cDNA was then synthesized using the SMARTer technology (Takara Bio) ...
-
bioRxiv - Immunology 2020Quote: ... HIV-1 RNA was isolated using the QIAcube (Qiagen) from mouse plasma using the QIAamp MinElute Virus Spin Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... 1:1,000 dilution of α-His-HRP antiserum (Qiagen), or 1:1,000 dilution of α-OmpA antiserum (Antibody Research Corporation ...