Labshake search
Citations for Qiagen :
451 - 500 of 3702 citations for 7 PHENYL 1 2 4 TRIAZOLO 1 5 A PYRIMIDINE 6 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The pellets were resuspended with OMV buffer and re-pelleted again by centrifugation at 100,000 g (31,000 RPM) for 2 h at 4°C and lysed with Qiazol followed by RNA isolation with the miRNeasy kit (Qiagen, Germantown, MD) to obtain total RNA including the small RNA fraction ...
-
bioRxiv - Genomics 2022Quote: The second lobe of lung or trachea was immersed in 1 mL PBS in a 2 mL Micro Centrifuge Tube (Fisherbrand, 14-666-315) containing one stainless steel bead (5 mm, QIAGEN, 1026563) immediately after dissecting the SARS-CoV-2 infected mouse or hamster ...
-
bioRxiv - Microbiology 2020Quote: ... and then with (2) 15 µl Proteinase K [>600 mA/ml] and 5 µl Rnase A [100 mg/ml] (Qiagen, Germany) for 5min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... or a non-targeting scrambled control (Scr; sequence: 5’-TAACACGTCTATACGCCCA-3; Qiagen, Cat No.: 339137; 0.1 nmol in 2 μL PBS), using a 2 μL Hamilton syringe at a rate of 1 μL/min ...
-
bioRxiv - Evolutionary Biology 2023Quote: Tissue pools were homogenised for 2 min at 30 Hz using 5 mm steel beads on a TissueLyser II instrument (Qiagen, Germany). A volume of 0.2× chloroform (Carl Roth ...
-
bioRxiv - Bioengineering 2024Quote: ... posterior eye cups (PECs) were separated and collected in 2 mL reinforced tubes (SPEX Sample Prep) containing 5 mM stainless steel beads (Qiagen, LLC).
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Genetics 2021Quote: ... and 7 healthy controls using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany) following the manufacturer isolation protocol ...
-
bioRxiv - Systems Biology 2019Quote: ... with custom miRCURY LNA PCR primers (Qiagen cat. no. 339306, Supplementary Table 7). Each 10 µL reaction volume contained 5 µL 2x miRCURY SYBR Green Master Mix ...
-
bioRxiv - Plant Biology 2021Quote: ... extracted in phosphate buffer (pH = 7) and finely ground using Tissuelyzer II (Qiagen) with settings of 30 seconds at 30 Hz ...
-
bioRxiv - Immunology 2020Quote: ... Supernatants were collected 7 days later and bound with Ni-NTA Agarose (Qiagen) in 20mM Sodium Phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: ... HGF (5’-CTCACACCCGCTGGGAGTAC-3’, 5’-TCCTTGACCTTGGATGCATTC-3’), STAT3 (5’-CTTTGAGACCGAGGTGTATCACC-3’, 5’-GGTCAGCATGTTGTACCACAGG-3’) and B-Actin Primer Set (Qiagen, QT00095431). After preparing master mixes samples were prepared in quadruplicate in a 96-well Reaction Microplates (Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... Protein extract (1 mg) was incubated with His6-RabD2c (1 μg) and Ni-NTA Agarose (QIAGEN) for 1 h at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... The aqueous phase was collected and mixed at a 1:1 ratio with 70% ethanol (Qiagen). RNA was isolated from this mixture using the RNeasy MinElute Kit (Qiagen) ...
-
bioRxiv - Microbiology 2020Quote: ... genomic DNA of FocnCong:1-1 was isolated using CTAB and 100/G genomic tips (QIAGEN) as described in the 1000 Fungal genomes project (http://1000.fungalgenomes.org) ...
-
bioRxiv - Microbiology 2021Quote: ... and incubated for 1 h at 55°C with 20 mg ml−1 proteinase K (Qiagen). Samples were treated for 10 min at 65 °C with 4 μl RNase A (100 mg ml−1 ...
-
bioRxiv - Microbiology 2021Quote: Cellular total RNA was prepared from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Genomics 2021Quote: ... Quantification of ACE2 transcript levels was performed by preparing total RNA from 2-4×106 cells for each sample using the RNeasy Plus Micro kit (Qiagen, Hilden Germany, #74034). For qRT-pCR ...
-
bioRxiv - Molecular Biology 2022Quote: Viral RNA was extracted from serially diluted and the 4 different media SARS-CoV-2 samples using the QIAamp Viral RNA Mini Kit (QIAGEN GmbH, Hilden, Germany). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1 µl 10x Taq buffer (Qiagen), 0.08 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of non-tailed primer ...
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen), and 0.2 μM of each of microsatellite forward and reverse primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1 μM template-switching oligonucleotides (QIAGEN), and 1 M betaine (Sigma 61962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... HIS-tag (Qiagen 34610 1:100) and HER3 (R&D Systems AF4518 1:400) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1 µM template-switching oligonucleotides (QIAGEN), and 1 M betaine ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and 1 μl 10X Buffer (Qiagen). PCR products were digested for 30 minutes at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Cignal EGR-1 reporter kit (Qiagen) was transfected in HEK293T following manufacturer protocol ...
-
bioRxiv - Cell Biology 2021Quote: βPix siRNA – #1 - AACAATCAACTGGTAGTAAGA (Qiagen S104239011), #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Genetics 2020Quote: ... 1× Multiplex PCR Master Mix (Qiagen) and 0.2 μM of each primer pair ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 x Qiagen PCR Buffer (Qiagen), 3 U APEX Taq (Genesee Scientific) ...
-
bioRxiv - Molecular Biology 2023Quote: ... containing 1 ml InhibitEx buffer (Qiagen). Two rounds of bead incubations were applied at 3.5 m/s for 2 min ...
-
bioRxiv - Neuroscience 2023Quote: ... 5ug of Ribonuclease 1 (Qiagen, 19101) was added to each sample followed by staining with 20ug propidium iodide (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... and oligo 5 (Q4) 5’-CACCGAGCTCTTCGCCGAGTA-3’ (Qiagen, SI03058272).
-
bioRxiv - Microbiology 2023Quote: ... 5 μL 5× One-step RT-PCR buffer (QIAGEN), 10 μL Triton-x100 (0.3% ...
-
bioRxiv - Microbiology 2020Quote: Ticks were homogenised in a 2 ml reaction tube with two 5 mm steel beads and 500 μl PBS using a Tissue Lyser II (Qiagen, Hilden, Germany) for 3 min at 30 Hz ...
-
bioRxiv - Cell Biology 2019Quote: ... 7 days-old seedlings and flower buds with the RNeasy Plant Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was collected from 7-12hr embryos per manufacturer’s specification (RNeasy kit, Qiagen), and submitted to Novogene (Sacramento ...
-
bioRxiv - Bioengineering 2019Quote: ... Cells were harvested after 3 or 7 days post-transfection (RNEasy mini kit, Qiagen), whereby cDNA was made and amplified via qPCR with primers for GAPDH ...
-
bioRxiv - Immunology 2019Quote: ... Multi-species alignment and cladrograms were constructed using CLC Main Workbench 7 (CLCbio, Qiagen).
-
bioRxiv - Microbiology 2020Quote: ... a total cold volume of 7 μl containing 300 ng random hexamers (Qiagen Operon), 12 U RNasin (Promega ...
-
bioRxiv - Immunology 2024Quote: ... a cold volume of 7 µL containing 300 ng of random hexamers (Qiagen Operon), 12 U Rnasin (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell lysates were centrifuged at 16,000 g for 5 min and supernatant was treated with 4 µL of RNase A (100 mg/mL) (Qiagen Singapore Pte. Ltd, Cat. No. 19101), gently mixed by flicking of tube and incubated at room temperature for 2 min ...
-
bioRxiv - Genomics 2022Quote: An aliquot of 150 μL of plasma per sample was thawed on ice and centrifuged at 3000 × g for 5 min at 4 °C and smallRNA was extracted using miRNeasy Serum/Plasma Kits (Qiagen, Cat. No. 217184, Milano, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and samples were diluted 1:1 in 70% ethanol and purified using RNeasy columns and reagents (QIAGEN). RNA concentration was measured using a NanoDrop spectrophotometer ...
-
bioRxiv - Systems Biology 2022Quote: ... 12 μl of 1 M Tris-HCl (pH 6.5) and 1 μl RNAse A (Qiagen cat # 19101) were added to the sample and incubated for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... and siNET1 #4 (Qiagen cat# SI00082040 ...
-
bioRxiv - Microbiology 2020Quote: ... followed by lysis in a 2 mL sure-lock tube containing 5 mm stainless steel homogenization beads using the TissueLyser LT (Qiagen, Germantown, MD, USA) for 30 seconds at 30 hz followed by 1 min of 30 hz while keeping the sample cold ...
-
bioRxiv - Cell Biology 2023Quote: ... siCASK #5 (Qiagen cat# SI02223368 ...
-
bioRxiv - Genomics 2020Quote: ... PCR products were cleaned-up using 1:1 of SPRI beads and eluted in 30µl elution buffer (Qiagen). The resulting amplicons were assayed on the Fragment Analyzer System (Agilent) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 ml of the non-stressed culture was added to 1 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...