Labshake search
Citations for Qiagen :
651 - 700 of 3853 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... 4 μL of 100 mg/mL RNase (Qiagen) was added ...
-
bioRxiv - Genomics 2019Quote: ... with the addition of 20 μl of proteinase K (20 mg/ml) followed by incubation at 56°C for 1-2 hr and the mitochondrial DNA was extracted by Qiagen DNeasy Blood & Tissue Kit (QIAGEN Inc.) ...
-
bioRxiv - Genomics 2019Quote: Total RNAs from the knockdown (shCTCF#1 and shCTCF#2) and control (shLuc) cells were extracted using miRNeasy Micro Kit (QIAGEN). cDNA was synthesized by using oligo (dT)20 and SuperScript III Reverse Transcriptase (Invitrogen ...
-
Oligomerization state of the functional bacterial twin arginine translocation (Tat) receptor complexbioRxiv - Biophysics 2021Quote: ... The supernatant was loaded onto a 10 x 1 cm column with 2 mL Ni-NTA Superflow resin (Cat. #30230, Qiagen) that was pre-equilibrated with Buffer A (10 mM CAPS ...
-
bioRxiv - Molecular Biology 2020Quote: RNA was extracted from 14-day-old wild-type and acinus-2 pinin-1 seedlings using RNeasy mini kit (Qiagen) and treated with TURBO DNA-free Kit (Ambion ...
-
The spatial landscape of progression and immunoediting in primary melanoma at single cell resolutionbioRxiv - Cancer Biology 2022Quote: ... The retrieved tissue mROIs were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... per condition or genotype were homogenized in 2-ml Eppendorf tubes containing lysis buffer with 1% beta-mercaptoethanol using a TissueLyser LT bead mill (Qiagen) and 5-mm stainless steel beads (Qiagen #69989) ...
-
bioRxiv - Neuroscience 2020Quote: ... GluA1 or GluA2Q (pIRES2-mCherry or pIRES2-EGFP) and CNIH2 (pRK5 or pBOS) plasmids were transfected at a 1:2 ratio using Effectene (QIAGEN) into adherent HEK293T cells (ATCC ...
-
bioRxiv - Genomics 2019Quote: ... 2D monolayers were lysed in RLT buffer supplemented with 1% 2-Mercaptoethanol before RNA purification using the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s instructions and including the on-column DNase digestion step ...
-
bioRxiv - Synthetic Biology 2020Quote: Cells were grown in triplicates on JMM 40 mM glycine and 40 mM pyruvate till mid-log phase and 1-2 mL of cultures were harvested and stabilized directly by RNA Protect Bacteria Kit (Qiagen). Cells were then lysed using lysozyme and beating with glass beads in a Retschmill (MM200 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue microregions were deposited with 2 µl PBS into PCR tubes containing 18 µl of lysis buffer: 1:16 mix of Proteinase K solution (QIAGEN) in PKD buffer (QIAGEN) ...
-
bioRxiv - Immunology 2021Quote: ... A total of 1-2 μg of RNA was used to synthesize the first single-strand cDNA using QuantiTect Reverse Transcription kit (Qiagen). For RT-PCR amplification ...
-
bioRxiv - Genomics 2021Quote: We began the assembly by first mapping long reads to the S288c reference genome (version R64-2-1) using CLC Genomics Workbench (Qiagen)(Fig ...
-
bioRxiv - Immunology 2020Quote: RNA was isolated from individual pools of 1×104 to 2×104 double-sorted SLAM cells using an RNEasy Micro kit (Qiagen). RNA was quantified and quality checked using an Agilent Bioanalyzer 2100 (Agilent) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 50uL of the dounce homogenized sample was labelled as “input” and added to 350uL RLT buffer with 1% 2-mercaptoethanol (Qiagen), followed by RNA extraction ...
-
bioRxiv - Biochemistry 2021Quote: ... and early stationary phase (OD = 1.0-1.3).1 mL sample of each culture was directly transferred to 2 mL RNAprotect cell reagent (Qiagen, Hilden, Germany). The samples were vortexed 5 sec ...
-
bioRxiv - Genomics 2022Quote: ... RNA (3 replicates each of V or E2 treated samples from donor 1 and donor 2) was DNAse treated and cleaned up using the RNeasy Mini kit (Qiagen) or the RNA Clean and Concentrator 5 kit (Zymo ...
-
bioRxiv - Immunology 2022Quote: Total RNA was prepared from 1-2*106 sorted naïve (CD25− CD44lowCD62high) or effector (CD25− CD44highCD62low) CD4+ T-cells using RNeasy Mini Kit (Qiagen Inc.) as described in manufacturer’s protocol including an on-column digestion step (RNaseFree DNase Set ...
-
bioRxiv - Cell Biology 2023Quote: ... RNA (2 μg per sample) extracted from 1×106 BSCs was performed using the Qiagen RNA RNeasy Kit (Cat#74104, Qiagen) followed by library preparation with the Illumina TruSeq V2 Kit (Cat#20020594 ...
-
bioRxiv - Microbiology 2024Quote: ... mixed with 1 mL phenol:chloroform:isoamyl alcohol (25:24:1 at pH 8) at 70°C for 12 min and bead beating for 2 min (Tissue Lyser II, Qiagen). The mixture was centrifuged at 4°C for 3 min at maximum speed and the aqueous phase was transferred to a new reaction tube ...
-
bioRxiv - Neuroscience 2024Quote: ... DRG and paw skin RNA was extracted using a RLT buffer:2-mercapto ethanol mixture in a 100:1 ratio/RNeasy (Qiagen) RNA mini kit according to the manufacturer’s instructions and spinal cord and spleen RNA was extracted using TRizol (Invitrogen)/RNeasy RNA mini kit ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were directly lysed in the well using 350 µL of lysing solution (1% 2-mercaptoethanol in Buffer RLT; RNeasy Mini Kit, 74106, Qiagen) by pipetting over the well ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 3 µg pINDUCER20-GFP-AFOS using PolyFect (Qiagen, 301107). Media was collected at 48 and 72 hours post-transfection and viral particles were precipitated using PEG-it™ Solution (System Biosciences ...
-
bioRxiv - Plant Biology 2022Quote: ... Hoko-3 using a Genomic-tip kit (Qiagen, Hilden, Germany). Library preparation was performed using SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... then lysed 3 times in a pre-cooled TissueLyser (QIAGEN). Proteins were dissolved in lysis buffer (4% SDS ...
-
bioRxiv - Cell Biology 2019Quote: ... Table 3 in the Rotor Gene Q 2plex cycler (Qiagen).
-
bioRxiv - Biochemistry 2023Quote: ... and mixed with 3 mL of Ni-NTA resin (Qiagen) for 1.0 h at 4 °C and then applied to a gravity flow column ...
-
bioRxiv - Molecular Biology 2023Quote: ... were crushed with a tungsten carbide bead (3 mm, Qiagen) on a Retsch MM400 mixer mill for 60 seconds at 30 Hz and DNA was extracted using the DNeasy Plant Mini kit (Qiagen) ...
-
bioRxiv - Genetics 2022Quote: ... The tissue powder was then transferred to a 1.5 mL centrifuge tube where 400 μL of 1% PVP-40 Buffer AP1 solution and 4 μL of RNase A were added (Qiagen DNeasy Plant Kit Qiagen Inc, Hilden, Germany). The tube was initially vortexed to homogenize the solution before incubation at 65 °C for 30 minutes with a short vortex every 5 minutes.
-
bioRxiv - Genomics 2022Quote: ... converted DNA was amplified using primers Fwd 5’ TTGATGGAGTAAAAGGAATTGTTTTAGG and Rev 5’ CCAATTCAAAAATTTAAAAAAAACAAAACC with HotStarTaq DNA Polymerase (QIAGEN). The PCR conditions were ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA from 10 adult flies (5 males/5 females) was extracted using DNeasy Blood & Tissue Kit (Qiagen). DNA was resuspended and sheared in 1X TE (0.1 mM EDTA ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were homogenized in 1 ml cell culture medium (see above) and a 5 mm steel bead in a TissueLyser (Qiagen, Hilden, Germany). Fecal samples were vortexed in sterile NaCl and the supernatant was sterile filtered (22µm ...
-
bioRxiv - Immunology 2020Quote: YFP+ Treg cells were sorted from spleen and LN of WT or Usp22fl/flFoxp3YFP-Cre mice (n=5 per group) and total RNA was isolated from 1×106 cells per sample using an RNeasy Mini Kit (Qiagen, Cat# 74104) as previously described47 ...
-
bioRxiv - Genetics 2020Quote: ... 30 mg of snap frozen tissues were processed adding 1 ml of QIAzol reagent in presence of one 5 mm stainless steel bead (Qiagen, Hilden, Germany). Total RNA isolation from homogenized tissues was performed using Qiagen RNeasy kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... and isolated keratinocytes and fibroblasts from the skin and Wound7 (n = 5/each group) (Table 1 and Table S1) by using the miRNeasy Mini kit (Qiagen, Hilden, Germany) and prepared for library construction ...
-
bioRxiv - Cancer Biology 2023Quote: ... we adapted the same conditions used in Dip-C40 and lysed each nucleus in 150 nL of lysis buffer containing 20 mM Tris pH8/20 mM NaCl/25 mM DTT/0.15% Triton X-100/1 mM EDTA/5 µg/mL Qiagen Protease (Qiagen, cat. no. 19157). After dispensing ...
-
bioRxiv - Immunology 2024Quote: Genomic DNA was then isolated from 1-5 million isolated PBMCs using the DNeasy Blood and Tissue kit (Qiagen; Cat. No. 69504) following manufacturer instructions ...
-
bioRxiv - Genetics 2020Quote: ... 5 µl Multiplex PCR Master Mix (QIAGEN), 0.2 µM of M13-tailed forward primer ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Genomics 2020Quote: ... 5 μl of RLT plus buffer (QIAGEN) and 60 fg of λ-DNA were added into each isolated nucleus to lyse nucleus completely ...
-
bioRxiv - Immunology 2021Quote: ... 5 ml packed Ni-NTA resin (Qiagen) were equilibrated in lysis buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl RT primers ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mm stainless steel beads (Qiagen). Phase separation was done by mixing 100 μl of Chloroform followed by centrifugation at 12000xg for 15 min in 4°C ...
-
bioRxiv - Immunology 2022Quote: ... with 5 μl of vapor-lock (QIAGEN) containing 100-200 nl of RT primers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 5 mm stainless steel beads (Qiagen). Sections were homogenized using a tissue lyser (Qiagen ...
-
bioRxiv - Neuroscience 2020Quote: ... Custom 5’ DIG labeled LNA probes (Qiagen) are as follows ...
-
bioRxiv - Immunology 2020Quote: ... or a 5 mm steel ball (Qiagen). For tissues ...
-
bioRxiv - Genetics 2020Quote: ... using 5 mm stainless steel bead (Qiagen) at 20 Hz for 4 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... 5 volumes of PB Buffer (Qiagen 28004) were added ...
-
bioRxiv - Immunology 2021Quote: ... using 5 mm stainless steel beads (Qiagen). RNA was extracted by the chloroform/isopropanol method and converted to cDNA as previously described ...