Labshake search
Citations for Qiagen :
451 - 500 of 3853 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: COS-7 cells were transfected with the respective Myc-Sun4-pEGFP fusion constructs using EffecteneTM (Qiagen) following the manufacturer’s protocol and incubated overnight before analysis of the ectopically expressed fusion proteins.
-
bioRxiv - Immunology 2020Quote: ... skin was homogenized in TRIzol using two 7 mm metal beads and a TissueLyser LT (Qiagen). Homogenates were centrifuged to separate an RNA containing aqueous phase ...
-
bioRxiv - Genetics 2020Quote: DNA from 7-day old leaves was extracted for all genotypes using the QIAamp kit (Qiagen) on the QIAcube HT (Qiagen ...
-
bioRxiv - Genetics 2019Quote: ... DNA from ~7×106 cells was extracted using a Blood & Cell Culture DNA Midi Kit (QIAGEN) and amplified to examine the coverage of mutant cell libraries ...
-
bioRxiv - Plant Biology 2021Quote: Total RNA was extracted from 7-day-old roots using the RNeasy Plant Mini Kit (Qiagen) and QIAcube (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Bioengineering 2020Quote: Around 250 mg of each produce sample was cut into 1-3 mm pieces using a scalpel and then processed with the DNeasy Powersoil Pro kit (Qiagen) to isolate 50μL of eluted DNA ...
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was purified 1-3 dpi from mock- or POWV-infected hBMECs or hPCs using RLT lysis buffer and RNeasy columns (Qiagen). Purified RNA was quantitated ...
-
bioRxiv - Genomics 2022Quote: ... Formalin-Fixed Paraffin-Embedded (FFPE) tissue (3 samples) and fresh frozen tissue (1 sample, QiaAmp Blood mini kit, QIAcube, QIAgen). Two samples are reference samples (NA24385 and NA12892 ...
-
bioRxiv - Genomics 2022Quote: ... the supernatants were mixed with Sigma HIS-Select Nickel Affinity Gel (at a ratio of 3:1) equilibrated in lysis buffer before being added into a polypropylene column (Qiagen). After extensive washing with a cold lysis buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA was extracted from pooled (n=10) embryonic zebrafish and pooled (n=3) adult (> 1 year) heart samples by QIAGEN RNEasy Lipid Tissue Extraction kit according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Bacterial RNA was isolated from LB cultures at OD600nm 1 and 3 in biological replicates using the QIAzol lysis reagent (Qiagen). The quantity of the bacterial RNA samples was measured on a NanoDrop ND1000 system and their quality analyzed on the Agilent 2100 Bioanalyzer system with the Agilent RNA 6000 Nano kit protocol (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... The LNA gapmers for lnc-FLii-1 and lnc-LSAMP-3 were designed and purchased along with negative control LNA from Qiagen. For transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... liver was homogenized in 500uL of 3:1:6 isopropanol:water:ethyl acetate containing internal standard in ceramic bead tubes (Qiagen #13113-50) using the TissueLyzer II (Qiagen #9244420) ...
-
bioRxiv - Microbiology 2023Quote: ... pHIVec2.luc reporter plasmid and psPAX2 packaging plasmid (catalog number 11348, NIH AIDS Reagent Program) in a ratio of 1:6:3 using either Effectene (Qiagen) or calcium phosphate ...
-
bioRxiv - Microbiology 2023Quote: ... round 1 and 3 virus infections of GeCKO-A549 cells using the midi gDNA extraction kit (Qiagen, Germantown, MD, USA). The sgRNA’s DNA copies were PCR amplified from the extracted gDNAs for next generation sequencing (Fig 1) ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Bioengineering 2021Quote: ... PCR 2 products were purified by 1% agarose gel using a QIAquick Gel Extraction Kit (Qiagen), eluting with 15 μL of Elution Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Tissues were homogenized in a mixture of chloroform and methanol (2:1) using TissueLyser II (Qiagen) and dried in a Vacufuge (Eppendorf ...
-
bioRxiv - Immunology 2021Quote: DNA from 1-2 stool pellets was extracted using the QIAamp DNA Stool Mini Kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Cultures samples were then mixed 1:2 with RNA Protect Bacteria Reagent (QIAGEN, Germantown, Maryland, USA), vortexed immediately for 5 seconds and incubated for 5 min at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were then treated with DpnI for 1-2 hr and then purified (QiaQuick, Qiagen) before use in library construction.
-
bioRxiv - Microbiology 2023Quote: ... each spot was collected into a 1:2 mix of LBS and RNAprotect Bacteria reagent (Qiagen), incubated at RT for 5 minutes ...
-
bioRxiv - Systems Biology 2023Quote: ... About 1 OD/mL cells were mixed with 2 volumes of RNAprotect Bacteria Reagent (Qiagen, 76506), and the cell pellet was collected by centrifuging at 2500 g for 8 minutes at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Ni-NTA agarose beads (Qiagen 70666-3)
-
bioRxiv - Genomics 2023Quote: Twenty 3 mm disc punches (UniCore, Qiagen) from each leaf sample were placed in mini-tubes with a 3 mm ball bearing ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 3 μL Vapor-Lock (Qiagen, 981611). Plates after sorting were briefly centrifuged ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Biophysics 2019Quote: ... Lysates were spun for a further 20 min at 40,000 g at 4 °C and resulting supernatants were incubated 1 hour with Ni2+-nitrilotriacetate (NTA) agarose beads (QIAGEN) at 4 °C on rotating wheel ...
-
bioRxiv - Microbiology 2019Quote: ... Cell lysates were then incubated at 4 °C for 1-1.5 hours on one ml of Ni-NTA resin (Qiagen). The resin was then loaded into columns (Biorad ...
-
bioRxiv - Physiology 2021Quote: ... 10-50 mg tissue was homogenized (1 mM EDTA and 4 mM sodiummetabisulfite, pH 7.4) using a TissueLyser II (Qiagen). Samples where adjusted to the same weight/volume percentage by adding a volume of homogenization buffer and the NA content was measured by ELISA (BA E-5200 ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysates were cleared for 30 min at 45,000 × g at 4°C and incubated with 1 ml of Ni-NTA agarose beads (Qiagen) per 1 l of expression culture for 2 h rotating at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Lysates were clarified by centrifugation for 1 h at 4°C at 10,000 rcf before being subjected to Ni-NTA (Qiagen) affinity purification following the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2023Quote: ... 4°C) and the supernatant incubated 1 hr at 4°C with 1.5 ml packed Ni-NTA Agarose beads (Qiagen). Beads were washed with buffer H adjusted to 50 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Developmental Biology 2022Quote: ... RNA was extracted from 3 knockout and 3 littermate control samples using the QIAGEN RNeasy Micro Kit (QIAGEN 74004) according to the manufacturers protocol ...
-
bioRxiv - Microbiology 2021Quote: ... prior to the addition of proteinase K and 5 μl of 100 mg ml−1 RNase A (Qiagen). The DNA concentration was determined using a Qubit fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: Whole RNA was extracted from over 1 × 10^5 cells using the QIAGEN RNeasy Micro kit (QIAGEN, 74004) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 0.5 µl of diluted template cDNA (1:3, nuclease-free water) per real-time PCR reaction (10 µl – SYBR Green PCR kit, Qiagen, 204143) was used to assay specific transcript abundance (CFX96 Real-Time System ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from homogenized lysate containing a range of 3×103 to 1×105 cells per sample using a ll Prep DNA/RNA Mini kit (Qiagen, #80204). RNA was purified and concentrated using RNAClean XP beads (Beckman Coulter ...
-
bioRxiv - Cancer Biology 2021Quote: ... 200 μL of plasma/EV suspension were mixed with 1000 μL Qiazol and 1 μL of a mix of 3 synthetic spike-in controls (Qiagen, Germany). After a 10-minute incubation at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: Adrenal glands were homogenized in ammonium-bicarbonate buffer (150 mM ammonium bicarbonate, pH 7) with TissueLyser (Qiagen). Protein content was assessed using BCA Protein Assay Kit (Thermo Fisher) ...
-
bioRxiv - Bioengineering 2021Quote: DNA was extracted from 0.5-7 mg biomass using DNeasy Powersoil microbial extraction kit (Qiagen, Hilden, Germany) accordingly to manufacturer’s instructions and stored at -20°C ...
-
bioRxiv - Plant Biology 2019Quote: ... total RNA was isolated from roots of 7-day-old seedlings using RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... and 7 were isolated using a Plant RNeasy Mini kit with DNase I treatment (Qiagen, Hilden, Germany). Three biological replicates were prepared for each tissue type ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA from the MC.7.G5 clone was extracted using the DNeasy Blood & Tissue Kit (Qiagen) and from blood by using either DNeasy Blood & Tissue Kit (Qiagen ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...