Labshake search
Citations for Qiagen :
351 - 400 of 1933 citations for 6H Pyrano 3 2 g benzothiazole 8CI 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: The genomic DNA of strains 16003 and 12E115 was purified using Genomic-tip 100/G (Qiagen). Libraries for Illumina sequencing (average insert size ...
-
bioRxiv - Plant Biology 2024Quote: Total DNA was extracted from 0.25 g of soil using the DNA PowerSoil PRO KIT (QIAGEN) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: RNA was extracted from CaCo-2 cells infected with SARS-CoV-2 using the RNeasy Mini kit (Qiagen) including an in-column DnaseI treatment step ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 ml of the non-stressed culture was added to 2 ml of the RNAprotect Bacteria Reagent (Qiagen), vortexed and incubated for 5 min at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... The supernatant was loaded over 3 ml of Ni-NTA beads (Qiagen) equilibrated in lysis buffer ...
-
bioRxiv - Immunology 2019Quote: ... and normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH; all primers from Qiagen).
-
bioRxiv - Evolutionary Biology 2019Quote: ... An additional bead-beating step using 3 mm carbide beads (Qiagen, UK) in a Qiagen tissue lyzer (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: The siRNA sequence (5’-GAGUAGAACUAGAAUGUGA-3’) targeting Hec1 was synthesized by Qiagen. The ON-TARGETplus SMARTpool siRNA sequences (5’-GAACGAGUAACCACAAUUA-3’) ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA against 3’UTR sequence of mouse Alr were purchased from Qiagen. siRNAs were transfected into HEK293 or MEF using Dharmafect 1 Transfection Reagent (Dharmacon) ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 1:3 mixture of a QuantiFast SYBR Green PCR Kit (Qiagen) and a FastStart SYBR Green Master (Roche ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected using siRNAs targeting MAD2 sequence 5′-AGAUGGAUAUAUGCCACGCTT-3′ (Qiagen), pools of siRNAs targeting the TP53 sequence 5’-GAAAUUUGCGUGUGGAGUA-3’ ...
-
bioRxiv - Genomics 2021Quote: ... The scramble-miR miRCURY LNA Detection probe (5’-GTGTAACACGTCTATACGCCCA-3’, YD00699004, QIAGEN) was used as a negative control ...
-
bioRxiv - Microbiology 2020Quote: ... for 3 hours at 37°C and purified using RNAeasy columns (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... The 3’ and 5’ – DIG labeled miRCURY LNA miRNA Detection probes (Qiagen, negative control Scramble-miR cat ...
-
bioRxiv - Genetics 2020Quote: ... the 3’ adaptor sequence (AACTGTAGGCACCATCAAT) was trimmed based on vendor’s recommendation (Qiagen). After adaptor trimming ...
-
bioRxiv - Microbiology 2023Quote: ... then resuspended in 3 mL of RNAprotect for bacterial cells (Qiagen, #76506). Planktonic cultures were similarly pelleted and resuspended in RNAprotect ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was then applied to a 3 mL Ni-NTA (Qiagen) column ...
-
bioRxiv - Biophysics 2022Quote: ... the supernatant was incubated overnight with 3 ml Ni-NTA beads (Qiagen) preequilibrated with the extraction buffer ...
-
bioRxiv - Immunology 2023Quote: Tissue was homogenized by using sterile 3-mm tungsten carbide beads (QIAGEN) in a TissueLyser II (QIAGEN ...
-
bioRxiv - Developmental Biology 2023Quote: ... tailbuds were individually lysed in 3 μL of RLT + BME (Qiagen RNeasy) and stored in separate PCR tubes at –80 °C to await genotyping of heads (for rad21-/- and rad21+/-) ...
-
bioRxiv - Cell Biology 2023Quote: ... mRNA was isolated from 3 dpf TL larvae (RNeasy, Qiagen; RNAlater, Invitrogen), and AffinityScript QPCR cDNA Synthesis Kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2024Quote: ... the tissue samples were homogenised using 3 mm stainless steel beads (Qiagen) and a TissueLyser II (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: Colon tissue fragments (3 mm, proximal colon) were stored in RNAlater (Qiagen) overnight at 4c ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... incubated with 2 ml nickel resin (Qiagen) and washed with 40 bead volumes of 40 mM imidazole in 30 mM Tris-HCl ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl 10X HotStar PCR buffer (Qiagen), 0.065 μl 5’ primer mix ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 2% volume of proteinase K solution (Qiagen) was added ...
-
BCR analysis of single-sorted, putative IgE+ memory B cells in food allergy: an ephemeral existence?bioRxiv - Immunology 2019Quote: ... 2 μL of 0.1 M Dithiothreitol (Qiagen), 1 μL of 10 mM each dNTP ...
-
bioRxiv - Cell Biology 2021Quote: ... 12.5 nM Dvl2 siRNA #2 (Qiagen, #SI00063441) 5’-CACGCTAAACATGGAGAAGTA-3’ ...
-
bioRxiv - Developmental Biology 2020Quote: ... PLCB1 siRNA #2 (CAGAGATGATCGGTCATATA) (Qiagen, Hs_PLCB1_6, SI02781184); PLCE1 siRNA#1(CAGGGTCTTGCCAGTCGACTA ...
-
bioRxiv - Immunology 2021Quote: ... added 2 ul of RNase A (Qiagen), and 2 ul of Proteinase K (RNA grade ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 volumes of RNA protect (Qiagen) were added ...
-
bioRxiv - Microbiology 2020Quote: Genomic DNA was extracted from ~10 g of thawed soil using Powermax Soil DNA extraction kit (Qiagen) with some minor modifications as follows ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Whole Genome Amplification (WGA) from single cells was performed by using REPLI-G Single Cell kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... genomic DNA was purified from freshly grown yeast cells using Genomic-tip 20/G column (QIAGEN 10223). DNA library was constructed using the TruSeq DNA PCR-Free Library Prep Kit (Illumina 20015962).
-
bioRxiv - Evolutionary Biology 2020Quote: ... citrichinaensis for PCR amplification was extracted with QIAGEN Genomic-tip 100/G (QIAGEN Benelux B.V., Venlo, Netherlands). PCR amplifications were performed with Phusion High Fidelity PCR Master Mix (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were harvested by centrifugation for 10 min at 3200 x g and resuspended in RNAprotect (Qiagen). RNA was isolated using the RNeasy mini kit (Qiagen) ...
-
bioRxiv - Microbiology 2021Quote: ... WGA was performed following the manufacturer’s protocol for the REPLI-g Single Cell Kit (Qiagen, Hilden, Germany).
-
bioRxiv - Genomics 2020Quote: ... Genomic DNA was extracted and purified using the Genomic-tip 20/G DNA extraction kit from Qiagen. Genome sequencing ...
-
bioRxiv - Microbiology 2021Quote: Genomic DNA was extracted from ~ 10 g of thawed soil using Powermax Soil DNA extraction kit (Qiagen) with some minor modifications as follows ...
-
bioRxiv - Cell Biology 2020Quote: ... 2.5ug of the plasmid of choice was transfected into HEK293T cells together with 1 ug pVSV-G and 1.5 ug pCMVΔR8.2 using an Effectene transfection kit (Qiagen). Twenty-four hours after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... DNA was extracted from 0.25 g peat per sample with the QIAGEN DNeasy Powersoil Kit (QIAGEN, Germany), according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: HMW gDNA was extracted from the legs of flash-frozen spiders using Genomic-tips 20/G (QIAGEN) based on previous studies 9 ...
-
Physiological Substrates and Ontogeny-Specific Expression of the Ubiquitin Ligases MARCH1 and MARCH8bioRxiv - Immunology 2021Quote: ... B220 (RA3-6B2) and Ly-6C/G (RB6-8C5) and anti-rat IgG-coupled magnetic beads (Qiagen) as previously described [34] ...
-
bioRxiv - Genetics 2020Quote: ... DNA samples whose concentration was insufficient were whole genome amplified using the REPLI-g Mini Kit (Qiagen). The relationship of the ascertained cats was confirmed using short tandem repeat (STR ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... DNA was extracted with a salting out method42 and amplified with the REPLI-g Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... 2.5 µl per sample (46.4-400 ng) was added to a REPLI-g Single Cell Kit (Qiagen) for whole genome amplification (WGA ...
-
bioRxiv - Genomics 2022Quote: ... DNA from I-73-1 and D308 was extracted using a ‘Genomic-tip 100/G’ kit (Qiagen) and long-reads sequenced with PacBio RS II at 100x coverage ...
-
bioRxiv - Microbiology 2022Quote: ... This product was then amplified by rolling circle amplification (RCA) using the Repli-g mini kit (Qiagen). The RCA product was linearized with SgrAI (NEB ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... the resulting cell pellet was subjected to whole genome amplification using the Repli-g midi kit (Qiagen) after which the DNA was purified using QIAamp DNA mini kit (Qiagen ...