Labshake search
Citations for Qiagen :
201 - 250 of 1363 citations for 6 Quinoxalinamine N ethyl 2 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: Total RNA was isolated from dissected brains (n = 9 brains per experimental cohort) by RNeasy Mini Kit (Qiagen, 74104), with on-column removal of genomic DNA (Qiagen ...
-
bioRxiv - Immunology 2023Quote: RNAseq was performed on total PBMCs from n=36 individuals in our cohort using the AllPrep kit as per manufacturer’s instructions (Qiagen). RNA libraries ...
-
bioRxiv - Microbiology 2020Quote: ... vIL-6 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) using QuantiTect Multiplex RT-PCR Kits (Qiagen) as described previously (37 ...
-
bioRxiv - Neuroscience 2020Quote: ... Amplified fragments were sequenced (Secugen S.L., Madrid) and analysed using CLC Sequence Viewer 6 (Qiagen).
-
bioRxiv - Molecular Biology 2022Quote: ... for 6 h at 55 °C followed by purification with a Qiaquick PCR Kit (Qiagen). Libraries were prepared using a MicroPlex Library Preparation Kit (Diagenode ...
-
bioRxiv - Genetics 2022Quote: ... Cells were transfected in 6-well plates at 80% confluency using Effectene transfection reagent (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was isolated from 5 or 6 Transwells using the RNeasy Micro Plus kit (Qiagen) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA (at least from 2.5* 10^6 cells) was purified onto RNeasy columns (Qiagen) and treated on-column with DNase (Qiagen) ...
-
bioRxiv - Plant Biology 2022Quote: ... and 6 days after being transferred into SIM medium using miRNeasy Mini Kit (QIAGEN, 217004). High-quality RNA was used to prepare sequencing libraries with the MGIEasy RNA library preparation kit ...
-
bioRxiv - Immunology 2020Quote: ... Gene specific primers for IL-6 (Hs_IL6_1_SG QuantiTect Primer Assay) was sourced from QuantiTect (Qiagen) primers ...
-
bioRxiv - Cell Biology 2022Quote: ... 5-6 cryosections were also collected for RNA extraction using RNAeasy Micro kit (Qiagen, 74004). Quality of the RNAs was determined by Tapestation (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... RNA was extracted from cells in 6 cm dishes using the RNeasy kit (Qiagen # 74106) according to manufacturer instructions ...
-
bioRxiv - Immunology 2022Quote: ... corpus (segment 6-7) and cauda (segment 8-10) samples using QIAzol Lysis Reagent (Qiagen) following the manufactureŕs recommendation using a bead-based tissue homogenizer (Retsch ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-λN-HA:dFMRP and 1 μg pAFW-AGO1 or pAFW-GW182 plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: S2 cell transfections were carried out in 6-well plates using Effectene transfection reagent (Qiagen). Each well was transfected with 1 μg of the pAc5.1-EGFP:dFMRP and 1 μg of pAc5.1-mCherry plasmids containing DCR1 ...
-
bioRxiv - Microbiology 2023Quote: Lungs from hamsters at 4 or 6 dpi were homogenized in PBS with TissueRuptor (Qiagen). A part of the whole lung homogenate was subjected to plaque assays for virus titration as described above ...
-
bioRxiv - Immunology 2023Quote: ... muris isolates (6 in total) were extracted via a DNeasy Blood and Tissue kit (Qiagen) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with guide RNAs for Rme-6 knockdown using Polyfect Transfection reagent (Qiagen), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... High speed supernatant was combined with 6 mL of Ni-NTA Agarose (Qiagen, Cat# 30230) and stirred in a beaker for 1-2 hour(s ...
-
bioRxiv - Microbiology 2024Quote: ... 1.5x105 Acanthamoeba castellanii cells were transfected with 6 μg of linearized plasmid using Polyfect (QIAGEN) in phosphate saline buffer (PBS) ...
-
bioRxiv - Immunology 2023Quote: SARS-CoV-2 specific T cell immune responses were evaluated by QuantiFERON SARS-CoV-2 (Qiagen) [36] ...
-
bioRxiv - Microbiology 2019Quote: ... containing 2 ml microcentrifuge tubes (QIAGEN) in which samples were placed ...
-
bioRxiv - Genomics 2020Quote: ... 2 μL of Buffer EB (Qiagen), and 30 μL of Hybridization Enhancer ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µg/mL RNase A (QIAgen), 1/200 (v/v ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mL Ni-NTA resin (Qiagen) was used for clarified cell lysate from 1 L bacterial culture ...
-
bioRxiv - Microbiology 2022Quote: ... 2) the DNeasy PowerWater Kit (Qiagen), which is optimized for the isolation of genomic DNA from filtered water samples ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Genomics 2023Quote: ... 2 µl 10x Reaction Buffer (Qiagen), 0.2 µl dNTP mix (10 µM) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and DNase I (2 mg (Qiagen) were dissolved in 30 mL of
-
bioRxiv - Microbiology 2024Quote: ... 2 volumes of RNA protect* (Qiagen) was added to cultures prior centrifugation (10 min 12,000 g ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 nM tRNA double DIG labeled LNA Probe targeting tRNAIleUAU (Sequence 5’ CA+GGTGAGGCTCGAACTCACAC+C+TCGGCAT+T+A 3’ with +N indicating LNA at that nucleotide) and tRNAIleGAU (Sequence 5’ AGTCGA+GCCCGCGAC+CTTGG+TGTTA+T+C 3’) (Qiagen) in 1X ISH buffer was denatured at 95°C for 5 minutes followed by cooling on ice for 1 minute ...
-
bioRxiv - Developmental Biology 2021Quote: RNA was extracted from appropriately staged embryos or whole larvae (n=10 /sample) using the RNeasy Plus Universal mini kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from heparinised blood of SI and SH mice (n=3 per housing group) using the RNeasy Protect Animal Blood Kit (Qiagen). Extracted RNA was hybridised at UCL genomics following standard Affymetrix protocols ...
-
bioRxiv - Genetics 2021Quote: ... 12 WT littermates) and two-month-old mice (adult, n = 4 per group) were lysed and homogenized in QIAzol Lysis Reagent (Qiagen). Total RNA purification was performed with the miRNeasy Micro Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: Whole blood samples from 10 healthy volunteers (n = 5 females and n = 5 males) aged from 25 to 37 were collected into PAX gene RNA blood tubes (Qiagen). Total RNA samples were isolated using QIAcube automation with the PAXgene Blood miRNA Kit (Qiagen ...
-
bioRxiv - Immunology 2021Quote: ... PRRSV-2 RNA was used to amplify cDNA encoding the full-length of N gene by RT-PCR (One-step RT-PCR, QIAGEN) using specific primers with the forward containing a T7 promoter sequence at the 5’ end ...
-
bioRxiv - Microbiology 2019Quote: ... coli BL21 (DE3) as fusion proteins containing an N-terminal His6- tag and purified by immobilized metal-affinity chromatography (Ni-NTA, Qiagen). Full-length DosR was also expressed with N-terminal GST-tag ...
-
bioRxiv - Microbiology 2020Quote: DNA extractions from the 8-week fecal samples (n = 8 per group) were performed using the Qiagen QIAmp DNA stool extraction kit (Qiagen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Genomic DNA from ∼250,000 neurons per sample (n = 3 samples per group) was extracted and purified (DNeasy Blood and Tissue DNA extraction kit, Qiagen) prior to RRBS (Ovation RRBS Methyl-Seq System ...
-
bioRxiv - Biophysics 2020Quote: ... All the constructs also contain a His6-tag at the N-terminus for affinity purification with Nickel-NTA agarose beads (Qiagen). Site-directed mutagenesis was performed using the QuickChange Lightning kit (Agilent Technology) ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant protein fragments were produced in Escherichia coli (strain M15) as fusion products with an N-terminal tag of six histidines using plasmid pQE30 (Qiagen) and purified from total bacterial lysates by nickel affinity chromatography ...
-
bioRxiv - Cancer Biology 2022Quote: Spheroid and monolayer samples (technical replicates n=3) of MUC-1 and NCI-H295R cells were processed for RNA extraction using the RNeasy Mini kit (Qiagen), followed by DNA removal (TURBO DNA-free™ Kit ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from single-cell clone or bulk GFP+ and GFP- cells (n = 3 with cells from three different mice in each group) using QIAzol lysis reagent (Qiagen). DNA was removed using the RNase-Free DNase Set (QIAGEN) ...
-
bioRxiv - Neuroscience 2019Quote: ... was extracted from P7 dissected neocortices separated from meninges of Ctrl and Nr2f1cKO mice (n=3) using the RNeasy Mini kit (Qiagen) following manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... total RNA was extracted from control and INPP5ED477N/D477N organoids (n=3 samples per genotype) using an RNeasy Plus Micro Kit (Qiagen) and reverse transcribed using Superscript™ IV VILO™ Master ezDNase enzyme (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2021Quote: ... total RNA was isolated from laser-microdissected control and mutant samples (n = 4) using the RNeasy Micro Plus Kit (Qiagen). The isolated RNA was checked for purity and integrity using Nanodrop spectrophotometer and TapeStation (Agilent) ...
-
bioRxiv - Biophysics 2020Quote: ... Cells were transiently transfected with cDNA encoding the mouse Piezo1 channel or its mutants tagged with GFP on its N-terminus in the pCDNA3 vector using the Effectene reagent (QIAGEN). Cells were then trypsinized and re-plated on poly-D-lysine-coated round coverslips 24 hours after transfection ...
-
bioRxiv - Microbiology 2022Quote: ... and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN, cat. n° 28704), according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2022Quote: ... Cell debris were removed by centrifugation (35,000 g at 4°C for 20 min) and the N-terminal His-tagged proteins were purified from the supernatant using NiNTA agarose (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted and purified from pooled scrambled control and genotyped cldn7b F0 knockout larvae (n=50 per group) at 7dpf using the RNeasy Plus Micro Kit (QIAGEN), followed by cDNA synthesis with the SuperScript IV VILO Master Mix Kit (ThermoFisher) ...