Labshake search
Citations for Qiagen :
101 - 150 of 1363 citations for 6 Quinoxalinamine N ethyl 2 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 6 µl Hi-Perfect transfection reagent (Qiagen, 301707), and 1 µl of the desired (20 µM ...
-
bioRxiv - Microbiology 2020Quote: ... or MHV-A59 N gene using RT2 SYBR Green qPCR Mastermix (330502, Qiagen) in the Bio-Rad CFX96 system ...
-
bioRxiv - Neuroscience 2020Quote: ... n=3) using the RNeasy Mini kit (Cat. No. 74104, QIAGEN, Hilden, German) and manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... His-N-WASP was first isolated using Ni-NTA beads (Qiagen, Valencia, CA) using a buffer with an imidazole gradient (20 mM Bis-Tris ...
-
bioRxiv - Immunology 2021Quote: RNA was extracted with RNeasy Mini kit (cat. n° 74106, Qiagen, Hilden, Germany), treated with the TURBO DNA-free™ kit (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2021Quote: ... DNA was extracted using Qiagen 96-well DNeasy kits (Qiagen P/N 69581). Sequencing libraries were prepared using the Illumina Nextera Kit and custom barcoded adapter sequences ...
-
bioRxiv - Plant Biology 2019Quote: ... Total RNA were extracted using RNeasy micro kit (Qiagen 74004, n°lot 136257409), tissues protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... HF n=8) using the Qiagen RNeasy Plus Mini Kit (Qiagen, Toronto ON). RNA was quantified by spectrophotometry (DeNovix ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... n = 3) from patient and control tissues using the RNeasy mini kit (Qiagen) and diluted to a concentration of 10ng/µL ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.1% N-Lauroylsarcosine salt and 0.2% Triton-X100 and passed through Miniprep (QIAGEN) silica-fibre membrane spin columns in order to bind only the Top2cc’s and not DNA ...
-
bioRxiv - Genomics 2022Quote: ... 400 nL of protease mix (6 μg protease (Qiagen, 19155), 6.25x NEBuffer 4 (NEB ...
-
bioRxiv - Microbiology 2021Quote: ... 6 and 9 employing the RNeasy plant mini kit (Qiagen). RNA was quantified using Nanodrop (Thermo Fisher ...
-
bioRxiv - Cell Biology 2023Quote: ... For MUS81 interference it was used FlexiTube HsMUS81 6 (Qiagen). SMARCAL1 was depleted using the MISSION esiRNA HUMAN SMARCAL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2023Quote: ... 6 million PBMCs were lysed using QIAzol Lysis Reagent (Qiagen). Samples were stored at -80°C until RNA extraction ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 µg C19orf43 (purified from E. coli BL21 through Qiagen Ni-TA agarose using standard procedures ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 mL of Ni2+-NTA slurry (Qiagen, Venlo, LI, Netherlands) were equilibrated in a gravity flow column with Wash Buffer (50 mM Tris-HCl ...
-
bioRxiv - Neuroscience 2023Quote: ... UniSpike 6 (included in the QIAGEN miRCURY LNA RT Kit) to verify the efficacy of reverse transcription (RT ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products were purified using the QIAquick PCR Purification kit (QIAGEN, cat. n° 28104), and digested DNA products were extracted from the agarose gel using the QIAquick Gel Extraction kit (QIAGEN ...
-
bioRxiv - Microbiology 2020Quote: ... N-terminal His-tagged proteins were purified using a QIAexpress protein purification system (Qiagen), as previously described47.
-
The alopecia areata phenotype is induced by the water avoidance stress test in cchcr1-deficient micebioRxiv - Genetics 2020Quote: ... RNA samples were purified by an RNeasy MinElute kit (QIAGEN N N.V., Venlo, Netherlands).
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Microbiology 2021Quote: Recombinant-construct with N-terminal His-tag was purified through IMAC-based Ni-NTA (Qiagen). IPTG induced ...
-
bioRxiv - Neuroscience 2021Quote: ... n=10) was homogenized using the PowerGen 125 handheld homogenizer in QIAzol Lysis Reagent (Qiagen) and extracted using the RNeasy Plus Universal Mini Kit (Qiagen) ...
-
bioRxiv - Biochemistry 2021Quote: ... containing an N-terminal His-tag was removed on a Ni-NTA agarose column (Qiagen). Proteins were additionally purified through a Superdex 200 26/60 size exclusion column (Pharmacia Biotech ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS ...
-
bioRxiv - Microbiology 2023Quote: ... Typhimurium strain were (n = 3) were extracted using the Rneasy kit (Qiagen Sciences, Maryland, USA), after an overnight culture in CBD tinted LB broth (for CBD-resistant strain ...
-
bioRxiv - Microbiology 2023Quote: ... Cellular RNAs were instead extracted using an RNAeasy mini extraction kit (Qiagen, cat. n. 74004) and then treated as described above ...
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...
-
bioRxiv - Neuroscience 2021Quote: RNA was extracted from SH-SY5Y and SK-N-DZ cells with a RNeasy kit (Qiagen) using the manufacturer‘s protocol including the on column DNA digestion step ...
-
bioRxiv - Microbiology 2021Quote: ... Larger DZIF N product fragments were excised and purified using the QIAquick Gel Extraction kit (Qiagen) and analyzed by Sanger sequencing using the DZIF N forward and reverse primers ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA from transfectant parasites was isolated with QIAamp DNA blood Kit (Qiagen, Cat. N° 51106) and diagnostic PCRs were set using Taq Phusion DNA polymerase (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... or FTA-dried blood spot samples (n = 26) using the QIAamp DNA Blood Mini Kit (Qiagen). For fecal samples ...
-
bioRxiv - Molecular Biology 2019Quote: Total RNA (n=3/experimental group) was extracted from macrophages with RNeasy Mini Kit (Qiagen, USA) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA was isolated (n = 3 or 4 mice per sample) using the RNeasy Mini Kit (QIAGEN), and aRNA was synthesized with Ambion’s MessageAmp aRNA Kit (Catalog # 1750 ...
-
bioRxiv - Developmental Biology 2023Quote: Total RNA was extracted from E17.5 hearts using the RNeasy Micro Kit (Qiagen; n = 4/genotype), followed by cDNA synthesis using the iScript cDNA Synthesis Kit (BioRad) ...
-
bioRxiv - Developmental Biology 2023Quote: ... total RNA was isolated from E17.5 hearts (n = 4/genotype) using a RNeasy Micro Kit (Qiagen). NanoString processing was completed by the Emory Integrated Genomics Core ...
-
bioRxiv - Cancer Biology 2024Quote: ... and total RNA was extracted using the RNAeasy Mini kit (Qiagen, 74104; n = 3 independent experiments). Prior to library construction ...
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAAGCGCAAACCTGAACGGAA (Qiagen S104308997)
-
bioRxiv - Cell Biology 2021Quote: ... #2 CAGTCGTGTCAGAAGAAGTTA (Qiagen S104318034)
-
Discovery of malathion resistance QTL in Drosophila melanogaster using a bulked phenotyping approachbioRxiv - Genetics 2022Quote: We isolated DNA from each pool of animals (2 replicates × 2 treatments × 2 sexes = 8 total pools) via the Gentra Puregene Cell Kit (Qiagen, 158767) using straightforward extensions of the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were harvested 6 h post-transfection and the extracted RNA (RNeasy, Qiagen) reverse transcribed to produce cDNA (QuantiTect ...
-
bioRxiv - Cell Biology 2020Quote: ... in the wells of 6 well plates (35mm) using Effectene transfection reagent(Qiagen) according to the manufacturer instructions ...