Labshake search
Citations for Qiagen :
351 - 400 of 2742 citations for 6 Bromo 4 5 dihydro 1H benzo b azepin 2 3H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... CcAP1 and CcFULLike-A and CcFULLike-B with CLC Genomics Workbench v21.0.3 (QIAGEN, Aarhus, Denmark) (Supplementary Table S5) ...
-
bioRxiv - Bioengineering 2024Quote: Sorted B cells were lysed for RNA extraction by the RNeasy Micro Kit (Qiagen, 74004). First-strand cDNA synthesis was performed on 8 μl of total RNA using 5 pmol of IgM and IgG specific primers in a 20 μl total reaction with SuperScript III (Thermo Fisher ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were harvested by the addition of one volume of RNAprotect bacterial reagent (Qiagen) followed by centrifugation at 4000 x g for 10 min ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... followed by a heteroduplex removal using a one cycle PCR and MinElute Purification (Qiagen) clean up ...
-
bioRxiv - Genomics 2020Quote: ... End-point RT-PCR was performed using the one-step RT-PCR kit (QIAGEN) following manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Human RAC2 3’UTR was amplified with One Step Ahead RT-PCR kit (Qiagen) from human mRNA using the following primers RAC2 3’UTR+ ...
-
bioRxiv - Cancer Biology 2021Quote: ... One-step qRT-PCR reactions were performed in triplicate using QuantiTech RT mix (QIAGEN) on the Bio-Rad C1000 Thermocycler and CFX96 system (Bio-Rad Laboratories ...
-
TrkB induced metastatic potential of cancer by suppression of BMP mediated tumor inhibitory activitybioRxiv - Cancer Biology 2020Quote: ... and RT-PCR analysis was performed using a One-Step RT-PCR kit (Qiagen) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: ... one each for RNAseq by freezing in Qiazol (Qiagen, Germantown, MD, USA, Cat #217004), mass spectrometry by freezing in PBS (FisherScientific ...
-
bioRxiv - Plant Biology 2020Quote: ... and ground for one minute at 20 m/s in a TissueLyser II (QIAGEN). Then ...
-
bioRxiv - Microbiology 2020Quote: ... One half was used for extraction using the DNeasy Blood and Tissue kit (Qiagen) or the GenElute Bacterial DNA extraction kit (#NA2110 ...
-
bioRxiv - Genomics 2021Quote: ... One fifth of the cells was used for plasmid DNA extraction (Qiagen, Hilden, Germany). The remaining cells underwent RNA extraction using the innuPREP RNA Mini Kit 2.0 (Analytik Jena ...
-
bioRxiv - Neuroscience 2023Quote: ... RNA was prepared from cells harvested one day post-transfection (RNeasy mini kit, Qiagen) and used for cDNA synthesis (iScript cDNA synthesis kit ...
-
bioRxiv - Microbiology 2023Quote: Lungs were collected in 500 µL of DPBS containing one stainless steel bead (QIAGEN), homogenized with the Tissue-Lyser II (QIAGEN) ...
-
bioRxiv - Plant Biology 2024Quote: ... One microgram was treated with DNase and reverse transcribed using the Quantitect kit (Qiagen) following the manufacturer instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... One µg of RNA was reverse transcribed using the miRScript II kit (218161; Qiagen) or miRCURY LNA RT Kit (339340 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Approximately 30 mg of frozen tissue was placed into a 2 ml flat bottom centrifuge tube on dry ice with a 5 mm stainless steel bead (QIAGEN Germantown, MD, USA; Cat#69989) at the bottom ...
-
bioRxiv - Microbiology 2021Quote: ... 5-plex (Qiagen, Germany), the QIAcuity One-Step Viral RT-PCR Kit (Cat No ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5 μM TSO (Qiagen). Amplification of cDNA (22 amplification cycles ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 PPKS/M and 4 PPKS/Y) using the AllPrep DNA/RNA Mini Kit (Qiagen). Indexed libraries were generates using the KAPA mRNA HyperPrep kit and sequenced on a NextSeq500 sequencer (NextSeq 500/550 High Output Kit v2.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... For SAS-6 knock down experiments siNegative control (siNegative, Qiagen, 1027310) and siSAS-6 (siSAS6 on-TARGET smart pool ...
-
bioRxiv - Plant Biology 2022Quote: ... 6 or 24 h using an RNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: RNA interference against MUS81 was performed using FlexiTube HsMUS81 6 (Qiagen) at final concentration of 10 nM using Lullaby 48 h before to perform experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6×105 cells were resuspended in 600 µl RLT buffer (Qiagen) and snap frozen on dry ice for later processing ...
-
bioRxiv - Immunology 2021Quote: Total RNA was extracted from fresh or cultured primary B cells using the RNeasy Minikit (Qiagen) or Trizol reagent (Ambion ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from the differentially stimulated B cells using the RNeasy Plus Micro Kit (Qiagen) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Genomic DNA was prepared from human or mouse B cells using QIAmp DNA Mini Kit (Qiagen), or from paraffin-embedded human IgD or IgA myeloma tissue sections (obtained from the University of Arkansas for Medical Science ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from B cell populations sorted in duplicates (Gentra Puregene Core Kit, Qiagen). Rearranged IGHV genes were sequenced by massive parallel sequencing ...
-
bioRxiv - Immunology 2021Quote: ... RNA was isolated from sorted B cells for each patient using the RNeasy Micro kit (Qiagen) with on-column DNase digestion ...
-
bioRxiv - Microbiology 2023Quote: ... gDNA was extracted using an isopropanol-ethanol purification kit (Puregene Yeast/Bact. Kit B from Qiagen) and following the manufacturer’s protocol including a 60-minute RNase A treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... 5×10^5 EpCAM+ve cells were lysed in 350μL RTL Buffer (Qiagen) containing 143mM β-Mercaptoethanol (aided by cell searing via passage ...
-
bioRxiv - Cell Biology 2019Quote: ... 10μL volume PCR assays were conducted using Quantifast One Step RT-PCR kit (Qiagen, UK) on a ViiA7™ Real-Time PCR System (Applied bio-systems ...
-
bioRxiv - Microbiology 2020Quote: ... Seven overlapping RT-PCR fragments were generated with the One-Step RT-PCR Kit (Qiagen) and purified using the Zymoclean Large Fragment DNA Recovery kit (Zymo Research) ...
-
bioRxiv - Microbiology 2021Quote: ... Viral RNA was quantified by one-step qRT-PCR using QuantiFast Probe PCR reagents (Qiagen) and primers and probes specific for the SARS-CoV2 sub-genomic E RNA as previously described (Corman et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and analysed using a one-step RT-PCR (PCR with reverse transcription) kit from Qiagen, both using the standard protocol ...
-
bioRxiv - Developmental Biology 2022Quote: RNA from one million cells was isolated using the RNeasy plus mini kit (Qiagen #74134). 5μg of RNA was subjected to ribosomal and mitochondrial RNA depletion using the RiboZero Gold kit (Human/Mouse/Rat ...
-
bioRxiv - Microbiology 2022Quote: ... One-step RT-qPCR was performed with QuantiFast Probe RT-PCR+ROX Vial Kit (Qiagen) on the Rotor-Gene Q (Qiagen) ...
-
bioRxiv - Cell Biology 2023Quote: ... One μg total RNA was used for cDNA synthesis using Quantinova Reverse Transcription kit (Qiagen). Real time PCR was performed in an ABI Prism 7500 (Applied Biosystems ...
-
bioRxiv - Genomics 2023Quote: ... Gel-based RT-PCR analyses were performed using the One-Step RT-PCR kit (Qiagen) in a final volume of 10 µL starting from 0.03 µg of DNase- treated (RQ1 Rnase-free Dnase supplemented with Rnasin Ribonuclease Inhibitor ...
-
bioRxiv - Neuroscience 2024Quote: ... CeA tissue was prepared for homogenization by placing one stainless steel bead (5mm) (Qiagen, PN69989) inside the tube ...
-
bioRxiv - Bioengineering 2019Quote: ... and 4 μL RNase (Qiagen, 19101) were mixed into one 1.5 microcentrifuge tube and transferred into the center of the column membrane for wetting the membrane ...
-
bioRxiv - Immunology 2019Quote: ... siNOD1 (Hs_ CARD4_ 4, SI00084483, QIAGEN), siRelA (AAGATCAATGGCTACACAGGA ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 μl DNase I (QIAGEN) and incubated for 1 hr at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 4 ml of RNA-protect (Qiagen) reagent were added on 2 ml of bacterial cultures during 5 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... E2D2/3 (5’-AACAGUAAUGGCAGCAUUUGU-3’) and E2D4 siRNAs (5’ – CCGAAUGACAGUCCUUACCAA-3’) all from Qiagen, USA(83).
-
bioRxiv - Neuroscience 2020Quote: ... and 6 h prior to RNA extraction with the RNeasy Minikit (Qiagen). Equal amounts were reverse transcribed via the QuantiTect Reverse Transcription kit (Qiagen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30s at 60°C on the Rotor-Gene Q 6-plex (QIAGEN). Mitochondrial copy number was calculated using the equation 2 × 2ΔCt ...
-
bioRxiv - Cell Biology 2022Quote: ... and 6×His-Flag-Ub was conducted using Ni-NTA agarose (Qiagen), following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... for 6 hours before RNA extraction using the RNeasy Mini kit (Qiagen). Complementary DNA (cDNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 6 and 8 dpi using Qiazol and the RNeasy mini kit (Qiagen). Purified RNAs were processed using Turbo DNase (Ambion DNAfree kit) ...